Result : EXP00798
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00798 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3463197 |
| Right | 3463250 |
| Strand | - |
| Nucleotide Sequence | GTGAATGATAACCTCGTTGCTCTTAAGCTCTGGCACAGTTGTTGCTACCACTGA |
| Sequence | VNDNLVALKLWHSCCYH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4320188 | 4320241 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3563731 | 3563784 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 3600816 | 3600869 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 3571334 | 3571387 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 2511265 | 2511318 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 4098083 | 4098136 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 261675 | 261728 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 8 | 2383691 | 2383747 | - | NZ_CP033744.1 | Citrobacter freundii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12568.10 | 0.71 | 5 | 2460.5 | opposite-strand | Acetyltransferase (GNAT) domain, PanZ |
| 2 | PF13458.8 | 0.86 | 6 | 1527.0 | same-strand | Periplasmic binding protein |
| 3 | PF01094.30 | 0.86 | 6 | 1527.0 | same-strand | Receptor family ligand binding region |
| 4 | PF13433.8 | 0.86 | 6 | 1527.0 | same-strand | Periplasmic binding protein domain |
| 5 | PF04545.18 | 1.0 | 7 | 33.0 | same-strand | Sigma-70, region 4 |
| 6 | PF04542.16 | 1.0 | 7 | 33.0 | same-strand | Sigma-70 region 2 |
| 7 | PF18075.3 | 1.0 | 7 | 159.0 | same-strand | FtsX extracellular domain |
| 8 | PF02687.23 | 1.0 | 7 | 159.0 | same-strand | FtsX-like permease family |
| 9 | PF00005.29 | 1.0 | 7 | 1210.0 | same-strand | ABC transporter |
| 10 | PF00448.24 | 1.0 | 7 | 1881.0 | same-strand | SRP54-type protein, GTPase domain |
| 11 | PF02881.21 | 1.0 | 7 | 1881.0 | same-strand | SRP54-type protein, helical bundle domain |
| 12 | PF03602.17 | 1.0 | 7 | 3537.5 | opposite-strand | Conserved hypothetical protein 95 |
| 13 | PF06611.14 | 1.0 | 7 | 4123.5 | opposite-strand | Protein of unknown function (DUF1145) |
++ More..