Result : EXP00791
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00791 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4307382 |
| Right | 4307444 |
| Strand | + |
| Nucleotide Sequence | TTGAAATTGCGGAAGCTGTCAAAGCGACGGGTGCTTCGGTCGTTCTTTTTGACCATGCCCTGA |
| Sequence | LKLRKLSKRRVLRSFFLTMP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5254715 | 5254777 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4400862 | 4400924 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3321343 | 3321405 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 3852425 | 3852487 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4505680 | 4505742 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01520.20 | 1.0 | 4 | 3460 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 2 | PF01119.21 | 1.0 | 4 | 1603 | same-strand | DNA mismatch repair protein, C-terminal domain |
| 3 | PF08676.13 | 1.0 | 4 | 1603 | same-strand | MutL C terminal dimerisation domain |
| 4 | PF01715.19 | 1.0 | 4 | 660 | same-strand | IPP transferase |
| 5 | PF17209.5 | 1.0 | 4 | 266 | same-strand | Hfq protein |
| 6 | PF13167.8 | 1.0 | 4 | -62 | same-strand | GTP-binding GTPase N-terminal |
| 7 | PF16360.7 | 1.0 | 4 | -62 | same-strand | GTP-binding GTPase Middle Region |
| 8 | PF01926.25 | 1.0 | 4 | -62 | same-strand | 50S ribosome-binding GTPase |
| 9 | PF02421.20 | 1.0 | 4 | -62 | same-strand | Ferrous iron transport protein B |
| 10 | PF01145.27 | 1.0 | 4 | 1745.0 | same-strand | SPFH domain / Band 7 family |
| 11 | PF12221.10 | 1.0 | 4 | 1114 | same-strand | Bacterial membrane protein N terminal |
| 12 | PF09838.11 | 1.0 | 4 | 3462 | same-strand | Uncharacterized protein conserved in bacteria (DUF2065) |
| 13 | PF00709.23 | 1.0 | 4 | 3763 | same-strand | Adenylosuccinate synthetase |
| 14 | PF02082.22 | 1.0 | 4 | 5266 | same-strand | Iron-dependent Transcriptional regulator |
++ More..