Result : EXP00790
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00790 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3499937 |
| Right | 3500020 |
| Strand | + |
| Nucleotide Sequence | ATCAAAAAAAGTCTATATTTCACTTTGCCCGCGCCGCGAAAGTCACTGATAATGCGCCGCGTTCATGTCCTCAAAATGGCGTAA |
| Sequence | IKKSLYFTLPAPRKSLIMRRVHVLKMA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 74534 | 74629 | - | NZ_CP023525.1 | Cedecea neteri |
| 2 | 1417607 | 1417705 | - | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
| 3 | 303958 | 304053 | - | NZ_CP045845.1 | Kluyvera intermedia |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP023525.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00582.28 | 1.0 | 3 | 2282 | same-strand | Universal stress protein family |
| 2 | PF10625.11 | 1.0 | 3 | 1580 | opposite-strand | Universal stress protein B (UspB) |
| 3 | PF01384.22 | 1.0 | 3 | 6 | same-strand | Phosphate transporter family |
| 4 | PF03486.16 | 1.0 | 3 | 174 | opposite-strand | HI0933-like protein |
++ More..