Result : EXP00788
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00788 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3719584 |
| Right | 3719652 |
| Strand | + |
| Nucleotide Sequence | ATGATGAAACACACAATGGTTCTTATCTTGATAGCTGGCTGCAATACAGCTGGTTTGATAATCATATAA |
| Sequence | MMKHTMVLILIAGCNTAGLIII |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3256483 | 3256548 | - | NZ_CP028271.1 | Mixta intestinalis |
| 2 | 1180692 | 1180766 | + | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 3 | 2004099 | 2004167 | - | NZ_LR134531.1 | Pragia fontium |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP028271.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03797.21 | 1.0 | 3 | -66.5 | same-strand | Autotransporter beta-domain |
| 2 | PF18883.2 | 1.0 | 3 | -68 | same-strand | Autochaperone Domain Type 1 |
++ More..