Result : EXP00785
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00785 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1165195 |
| Right | 1165278 |
| Strand | + |
| Nucleotide Sequence | GTGAATCTTGATGACAAAAATGAGTCGCTACGCCTTGATTACCGCGCTGGCGATGTTTCTCGCCGGGTGTGTGGGGCAACGTGA |
| Sequence | VNLDDKNESLRLDYRAGDVSRRVCGAT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 12
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1150346 | 1150429 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 1521876 | 1521959 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1162628 | 1162711 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1743645 | 1743728 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1803490 | 1803573 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 1168424 | 1168507 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 3614086 | 3614169 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 8 | 3456551 | 3456634 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 386088 | 386171 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 10 | 539752 | 539835 | + | NZ_CP038469.1 | Citrobacter tructae |
| 11 | 1823351 | 1823434 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 3681379 | 3681477 | + | NZ_CP053416.1 | Salmonella bongori |
| 13 | 1291133 | 1291231 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02378.20 | 0.83 | 10 | 3338 | same-strand | Phosphotransferase system, EIIC |
| 2 | PF00367.22 | 0.83 | 10 | 3338 | same-strand | phosphotransferase system, EIIB |
| 3 | PF07715.17 | 0.83 | 10 | 1089 | opposite-strand | TonB-dependent Receptor Plug Domain |
| 4 | PF01230.25 | 1.0 | 12 | 384 | same-strand | HIT domain |
| 5 | PF11969.10 | 1.0 | 12 | 384 | same-strand | Scavenger mRNA decapping enzyme C-term binding |
| 6 | PF07233.14 | 1.0 | 12 | 4 | same-strand | Protein of unknown function (DUF1425) |
| 7 | PF01636.25 | 1.0 | 12 | 549 | same-strand | Phosphotransferase enzyme family |
| 8 | PF00933.23 | 1.0 | 12 | 1384 | same-strand | Glycosyl hydrolase family 3 N terminal domain |
| 9 | PF05728.14 | 1.0 | 12 | 2431 | same-strand | Uncharacterised protein family (UPF0227) |
| 10 | PF07992.16 | 1.0 | 12 | 3256 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 11 | PF00070.29 | 1.0 | 12 | 3256 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 12 | PF01026.23 | 0.75 | 9 | 5060.0 | same-strand | TatD related DNase |
| 13 | PF00593.26 | 0.75 | 9 | 1089.0 | opposite-strand | TonB dependent receptor |
| 14 | PF13036.8 | 0.92 | 11 | -73.0 | same-strand | Peptidoglycan-synthase activator LpoB |
++ More..