Result : EXP00779

Protein Information

• Protein name: EXP00779
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 2562432
• Right: 2562497
• Strand: +
• Nucleotide Sequence: ATGATTTTGATTACGTCGATACGCGCACATTTTTACGCGCCGTCGATGCGGTACTGCCGCAGTTAA
• Sequence: MILITSIRAHFYAPSMRYCRS
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 21

Conservation Analysis

No. of Species: 7

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3417127	3417192	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	2696609	2696674	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	2681480	2681545	+	NC_004337.2	Shigella flexneri 2a str. 301
4	1057150	1057215	-	NZ_CP061527.1	Shigella dysenteriae
5	2654943	2655008	+	NZ_AP014857.1	Escherichia albertii
6	4075088	4075153	-	NZ_CP057657.1	Escherichia fergusonii
7	3217175	3217240	+	NZ_LR134340.1	Escherichia marmotae
8	618114	618170	+	NZ_CP058952.1	Chitinibacter fontanus

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00158.28	0.86	6	7815	opposite-strand	Sigma-54 interaction domain
2	PF00072.26	0.86	6	7811.0	opposite-strand	Response regulator receiver domain
3	PF14532.8	0.86	6	7815	opposite-strand	Sigma-54 interaction domain
4	PF00004.31	0.71	5	7819.0	opposite-strand	ATPase family associated with various cellular activities (AAA)
5	PF13942.8	0.86	6	7112	opposite-strand	YfhG lipoprotein
6	PF02518.28	0.86	6	5565	opposite-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
7	PF00512.27	0.86	6	5565	opposite-strand	His Kinase A (phospho-acceptor) domain
8	PF13507.8	0.86	6	1066	opposite-strand	CobB/CobQ-like glutamine amidotransferase domain
9	PF18076.3	0.86	6	1066	opposite-strand	Formylglycinamide ribonucleotide amidotransferase N-terminal
10	PF02769.24	0.86	6	1066	opposite-strand	AIR synthase related protein, C-terminal domain
11	PF18072.3	0.86	6	1066	opposite-strand	Formylglycinamide ribonucleotide amidotransferase linker domain
12	PF00497.22	0.86	6	-65	same-strand	Bacterial extracellular solute-binding proteins, family 3
13	PF01464.22	0.86	6	-65	same-strand	Transglycosylase SLT domain
14	PF14437.8	0.86	6	680	opposite-strand	MafB19-like deaminase
15	PF00383.25	0.86	6	680	opposite-strand	Cytidine and deoxycytidylate deaminase zinc-binding region
16	PF12710.9	0.86	6	1241	opposite-strand	haloacid dehalogenase-like hydrolase
17	PF01380.24	0.86	6	2085	same-strand	SIS domain
18	PF01418.19	0.86	6	2085	same-strand	Helix-turn-helix domain, rpiR family