Result : EXP00777

Protein Information

• Protein name: EXP00777
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 675183
• Right: 675266
• Strand: +
• Nucleotide Sequence: ATTGAATTTAAGCGATTTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCAAAAACAACGAACACTTTGTCAACAAACTGA
• Sequence: IEFKRFCRPDKAFTPHPAKTTNTLSTN
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 27

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	715300	715392	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	216036	216107	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	3888621	3888713	-	NZ_LR134340.1	Escherichia marmotae
4	1077768	1077860	+	NZ_AP014857.1	Escherichia albertii
5	2265443	2265526	-	NZ_AP014857.1	Escherichia albertii
6	309571	309645	+	NZ_AP014857.1	Escherichia albertii
7	1509642	1509728	+	NZ_AP014857.1	Escherichia albertii
8	219369	219440	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00258.27	0.67	2	2058.5	opposite-strand	Flavodoxin
2	PF13520.8	0.67	2	794.5	opposite-strand	Amino acid permease
3	PF00324.23	0.67	2	794.5	opposite-strand	Amino acid permease