Result : EXP00774
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00774 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4087684 |
| Right | 4087743 |
| Strand | + |
| Nucleotide Sequence | ATGCTTAATGCAGACGTATATCCGAGATATTCGGGTTGTGGCAAGGCGGCAACTGAGTGA |
| Sequence | MLNADVYPRYSGCGKAATE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4179633 | 4179692 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4199386 | 4199445 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 3122666 | 3122725 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 112140 | 112199 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4152068 | 4152130 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00009.29 | 1.0 | 5 | 2505 | same-strand | Elongation factor Tu GTP binding domain |
| 2 | PF03143.19 | 1.0 | 5 | 2505 | same-strand | Elongation factor Tu C-terminal domain |
| 3 | PF03144.27 | 1.0 | 5 | 2505 | same-strand | Elongation factor Tu domain 2 |
| 4 | PF01926.25 | 1.0 | 5 | 2505 | same-strand | 50S ribosome-binding GTPase |
| 5 | PF00584.22 | 1.0 | 5 | 1892 | same-strand | SecE/Sec61-gamma subunits of protein translocation complex |
| 6 | PF02357.21 | 1.0 | 5 | 1345 | same-strand | Transcription termination factor nusG |
| 7 | PF00467.31 | 1.0 | 5 | 1345 | same-strand | KOW motif |
| 8 | PF03946.16 | 1.0 | 5 | 758 | same-strand | Ribosomal protein L11, N-terminal domain |
| 9 | PF00298.21 | 1.0 | 5 | 758 | same-strand | Ribosomal protein L11, RNA binding domain |
| 10 | PF00687.23 | 1.0 | 5 | 50 | same-strand | Ribosomal protein L1p/L10e family |
| 11 | PF00466.22 | 1.0 | 5 | 304 | same-strand | Ribosomal protein L10 |
| 12 | PF00542.21 | 1.0 | 5 | 868 | same-strand | Ribosomal protein L7/L12 C-terminal domain |
| 13 | PF16320.7 | 1.0 | 5 | 868 | same-strand | Ribosomal protein L7/L12 dimerisation domain |
| 14 | PF00562.30 | 1.0 | 5 | 1553 | same-strand | RNA polymerase Rpb2, domain 6 |
| 15 | PF04563.17 | 1.0 | 5 | 1553 | same-strand | RNA polymerase beta subunit |
| 16 | PF04565.18 | 1.0 | 5 | 1553 | same-strand | RNA polymerase Rpb2, domain 3 |
| 17 | PF10385.11 | 1.0 | 5 | 1553 | same-strand | RNA polymerase beta subunit external 1 domain |
| 18 | PF04560.22 | 1.0 | 5 | 1553 | same-strand | RNA polymerase Rpb2, domain 7 |
| 19 | PF04997.14 | 1.0 | 5 | 5658 | same-strand | RNA polymerase Rpb1, domain 1 |
| 20 | PF04998.19 | 1.0 | 5 | 5658 | same-strand | RNA polymerase Rpb1, domain 5 |
| 21 | PF04983.20 | 1.0 | 5 | 5658 | same-strand | RNA polymerase Rpb1, domain 3 |
| 22 | PF05000.19 | 1.0 | 5 | 5658 | same-strand | RNA polymerase Rpb1, domain 4 |
| 23 | PF06968.15 | 0.6 | 3 | 10123 | opposite-strand | Biotin and Thiamin Synthesis associated domain |
| 24 | PF04055.23 | 0.6 | 3 | 10123 | opposite-strand | Radical SAM superfamily |
++ More..