Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00769 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 4080511 |
Right | 4080555 |
Strand | + |
Nucleotide Sequence | ATGTTGATTGTGTTGAACTGGCGACAGGCAAGCAAGTGCGCTTAA |
Sequence | MLIVLNWRQASKCA |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 14 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4981604 | 4981648 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 4192212 | 4192256 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
3 | 104967 | 105011 | + | NZ_CP061527.1 | Shigella dysenteriae |
4 | 4172460 | 4172504 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
5 | 4144899 | 4144943 | + | NZ_AP014857.1 | Escherichia albertii |
6 | 3115493 | 3115537 | + | NZ_CP057657.1 | Escherichia fergusonii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF05958.13 | 0.8 | 4 | 8936.5 | opposite-strand | tRNA (Uracil-5-)-methyltransferase |
2 | PF00593.26 | 1.0 | 5 | 6775.5 | same-strand | TonB dependent receptor |
3 | PF07715.17 | 1.0 | 5 | 6775.5 | same-strand | TonB-dependent Receptor Plug Domain |
4 | PF01177.24 | 1.0 | 5 | 5973.5 | same-strand | Asp/Glu/Hydantoin racemase |
5 | PF02873.18 | 1.0 | 5 | -44.0 | same-strand | UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain |
6 | PF01565.25 | 1.0 | 5 | -44.0 | same-strand | FAD binding domain |
7 | PF03099.21 | 1.0 | 5 | 578.0 | same-strand | Biotin/lipoate A/B protein ligase family |
8 | PF08279.14 | 1.0 | 5 | 578.0 | same-strand | HTH domain |
9 | PF02237.19 | 1.0 | 5 | 578.0 | same-strand | Biotin protein ligase C terminal domain |
10 | PF00009.29 | 1.0 | 5 | 3440.0 | same-strand | Elongation factor Tu GTP binding domain |
11 | PF03143.19 | 1.0 | 5 | 3440.0 | same-strand | Elongation factor Tu C-terminal domain |
12 | PF03144.27 | 1.0 | 5 | 3440.0 | same-strand | Elongation factor Tu domain 2 |
13 | PF01926.25 | 1.0 | 5 | 3440.0 | same-strand | 50S ribosome-binding GTPase |
14 | PF00584.22 | 1.0 | 5 | 4854.0 | same-strand | SecE/Sec61-gamma subunits of protein translocation complex |
15 | PF02357.21 | 1.0 | 5 | 5239.0 | same-strand | Transcription termination factor nusG |
16 | PF00467.31 | 1.0 | 5 | 5239.0 | same-strand | KOW motif |