Result : EXP00768
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00768 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1154425 |
| Right | 1154475 |
| Strand | + |
| Nucleotide Sequence | ATCTCCAGGCGGTCGTTCGACCGCCTGAGTTTTATCTTTTTGTCCCACTAG |
| Sequence | ISRRSFDRLSFIFLSH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1742643 | 1742690 | + | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 2 | 2339825 | 2339872 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 3 | 1705706 | 1705753 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 4 | 1693020 | 1693067 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 5 | 1705543 | 1705590 | - | NZ_CP027107.1 | Cronobacter sakazakii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012268.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08541.12 | 1.0 | 5 | 2087 | same-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal |
| 2 | PF08545.12 | 1.0 | 5 | 2087 | same-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III |
| 3 | PF00698.23 | 1.0 | 5 | 1140 | same-strand | Acyl transferase domain |
| 4 | PF13561.8 | 1.0 | 5 | 392 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 5 | PF00106.27 | 1.0 | 5 | 392 | same-strand | short chain dehydrogenase |
| 6 | PF08659.12 | 1.0 | 5 | 392 | same-strand | KR domain |
| 7 | PF13460.8 | 1.0 | 5 | 392 | same-strand | NAD(P)H-binding |
| 8 | PF00550.27 | 1.0 | 5 | 1 | same-strand | Phosphopantetheine attachment site |
| 9 | PF00109.28 | 1.0 | 5 | 45 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
| 10 | PF02801.24 | 1.0 | 5 | 45 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
| 11 | PF01063.21 | 1.0 | 5 | 1395 | same-strand | Amino-transferase class IV |
| 12 | PF02618.18 | 1.0 | 5 | 2206 | same-strand | YceG-like family |
| 13 | PF02223.19 | 1.0 | 5 | 3218 | same-strand | Thymidylate kinase |
| 14 | PF13521.8 | 1.0 | 5 | 3218 | same-strand | AAA domain |
| 15 | PF13177.8 | 1.0 | 5 | 3856 | same-strand | DNA polymerase III, delta subunit |
| 16 | PF09115.12 | 1.0 | 5 | 3856 | same-strand | DNA polymerase III, delta subunit, C terminal |
| 17 | PF02504.17 | 0.8 | 4 | 3047.0 | same-strand | Fatty acid synthesis protein |
++ More..