Result : EXP00767
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00767 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3044702 |
| Right | 3044776 |
| Strand | + |
| Nucleotide Sequence | GTGTGTAACGCTTCATTTATGCCCACTCATTTTTTAACGCTTGATGATGCAGCTGCAGCCATTGCAAAGCGATGA |
| Sequence | VCNASFMPTHFLTLDDAAAAIAKR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3923487 | 3923561 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3177265 | 3177339 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3170400 | 3170474 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 637845 | 637919 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3700029 | 3700103 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3165839 | 3165913 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00204.27 | 1.0 | 5 | 1869.0 | opposite-strand | DNA gyrase B |
| 2 | PF00986.23 | 1.0 | 5 | 1869.0 | opposite-strand | DNA gyrase B subunit, carboxyl terminus |
| 3 | PF02518.28 | 1.0 | 5 | 1869.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 4 | PF01751.24 | 1.0 | 5 | 1869.0 | opposite-strand | Toprim domain |
| 5 | PF05728.14 | 1.0 | 5 | 1259.0 | opposite-strand | Uncharacterised protein family (UPF0227) |
| 6 | PF00149.30 | 1.0 | 5 | 432.0 | opposite-strand | Calcineurin-like phosphoesterase |
| 7 | PF06853.14 | 1.0 | 5 | -15.0 | opposite-strand | Protein of unknown function (DUF1249) |
| 8 | PF00293.30 | 1.0 | 5 | -58.0 | opposite-strand | NUDIX domain |
| 9 | PF02321.20 | 1.0 | 5 | 776.0 | same-strand | Outer membrane efflux protein |
| 10 | PF06693.13 | 1.0 | 5 | 2405.0 | same-strand | Protein of unknown function (DUF1190) |
| 11 | PF03738.16 | 1.0 | 5 | 3082.0 | same-strand | Glutathionylspermidine synthase preATP-grasp |
| 12 | PF03992.18 | 0.8 | 4 | 3809.0 | same-strand | Antibiotic biosynthesis monooxygenase |
++ More..