Result : EXP00764
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00764 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4021109 |
| Right | 4021153 |
| Strand | + |
| Nucleotide Sequence | TTGAGCTTGATGCGGCCTTCACCTTCTCATGCCAGGCCGAGATGA |
| Sequence | LSLMRPSPSHARPR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4913273 | 4913317 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 139319 | 139363 | + | NZ_LR134340.1 | Escherichia marmotae |
| 3 | 33664 | 33708 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 4113187 | 4113231 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 4128169 | 4128213 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02611.17 | 0.75 | 3 | 2502.0 | same-strand | CDP-diacylglycerol pyrophosphatase |
| 2 | PF00121.20 | 0.75 | 3 | 1680.0 | opposite-strand | Triosephosphate isomerase |
| 3 | PF07305.14 | 1.0 | 4 | 973 | opposite-strand | Protein of unknown function (DUF1454) |
| 4 | PF05656.16 | 0.75 | 3 | 432.0 | same-strand | Protein of unknown function (DUF805) |
| 5 | PF04175.14 | 1.0 | 4 | -44 | same-strand | Protein of unknown function (DUF406) |
| 6 | PF00582.28 | 1.0 | 4 | 62 | same-strand | Universal stress protein family |
| 7 | PF00175.23 | 1.0 | 4 | 495 | opposite-strand | Oxidoreductase NAD-binding domain |
| 8 | PF03320.15 | 1.0 | 4 | 1338 | opposite-strand | Bacterial fructose-1,6-bisphosphatase, glpX-encoded |
| 9 | PF00370.23 | 1.0 | 4 | 2578 | opposite-strand | FGGY family of carbohydrate kinases, N-terminal domain |
| 10 | PF02782.18 | 1.0 | 4 | 2578 | opposite-strand | FGGY family of carbohydrate kinases, C-terminal domain |
| 11 | PF00230.22 | 1.0 | 4 | 4109 | opposite-strand | Major intrinsic protein |
++ More..