Result : EXP00761
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00761 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3475307 |
| Right | 3475351 |
| Strand | + |
| Nucleotide Sequence | GTGATACGATACGCACTTTCATTTTCCATTAAACGTTGGCCCTGA |
| Sequence | VIRYALSFSIKRWP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3583446 | 3583490 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 3612923 | 3612967 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3576875 | 3576919 | + | NZ_AP014857.1 | Escherichia albertii |
| 4 | 4110738 | 4110782 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01206.19 | 1.0 | 4 | 3927.0 | opposite-strand | Sulfurtransferase TusA |
| 2 | PF02592.17 | 1.0 | 4 | 3041.5 | same-strand | Putative vitamin uptake transporter |
| 3 | PF08786.13 | 1.0 | 4 | 2411.0 | same-strand | DcrB |
| 4 | PF01594.18 | 1.0 | 4 | 9.0 | same-strand | AI-2E family transporter |
| 5 | PF00496.24 | 1.0 | 4 | 700.0 | same-strand | Bacterial extracellular solute-binding proteins, family 5 Middle |
| 6 | PF00528.24 | 1.0 | 4 | 2744.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 7 | PF19300.1 | 1.0 | 4 | 2274.0 | same-strand | Binding-prot-dependent transport system membrane comp, N-term |
| 8 | PF00005.29 | 0.75 | 3 | 4048 | same-strand | ABC transporter |
++ More..