Result : EXP00759
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00759 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1713496 |
| Right | 1713549 |
| Strand | + |
| Nucleotide Sequence | ATGTTCGTCAGCCCAGGGATGTCGCACAAATTCTGCTTTCGGTGCTGTTTTTAG |
| Sequence | MFVSPGMSHKFCFRCCF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2368930 | 2368983 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1769081 | 1769134 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1751996 | 1752049 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2050137 | 2050190 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 2066533 | 2066586 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 389568 | 389621 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 1446170 | 1446223 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01521.22 | 0.83 | 5 | 4695.0 | opposite-strand | Iron-sulphur cluster biosynthesis |
| 2 | PF15930.7 | 1.0 | 6 | 3959 | opposite-strand | Domain of unknown function |
| 3 | PF03061.24 | 1.0 | 6 | 3449 | opposite-strand | Thioesterase superfamily |
| 4 | PF02913.21 | 1.0 | 6 | 396 | opposite-strand | FAD linked oxidases, C-terminal domain |
| 5 | PF01565.25 | 1.0 | 6 | 396 | opposite-strand | FAD binding domain |
| 6 | PF13183.8 | 1.0 | 6 | 396 | opposite-strand | 4Fe-4S dicluster domain |
| 7 | PF01594.18 | 1.0 | 6 | -53 | same-strand | AI-2E family transporter |
| 8 | PF08965.12 | 1.0 | 6 | 1481 | same-strand | Domain of unknown function (DUF1870) |
| 9 | PF18317.3 | 0.67 | 4 | 4655 | same-strand | Shikimate 5'-dehydrogenase C-terminal domain |
++ More..