Result : EXP00754
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00754 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1331549 |
| Right | 1331593 |
| Strand | + |
| Nucleotide Sequence | TTGAGTTCCTGGAGAACCTGTTTCAGGGCGGTGAAAATGGTTTGA |
| Sequence | LSSWRTCFRAVKMV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1846024 | 1846068 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1345181 | 1345225 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1339465 | 1339509 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2350462 | 2350506 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01253.24 | 1.0 | 3 | 2197.0 | same-strand | Translation initiation factor SUI1 |
| 2 | PF05433.17 | 0.67 | 2 | 1853 | opposite-strand | Glycine zipper 2TM domain |
| 3 | PF13441.8 | 0.67 | 2 | 1853 | opposite-strand | YMGG-like Gly-zipper |
| 4 | PF13488.8 | 0.67 | 2 | 1853 | opposite-strand | Glycine zipper |
| 5 | PF00455.24 | 1.0 | 3 | 835.0 | opposite-strand | DeoR C terminal sensor domain |
| 6 | PF08220.14 | 1.0 | 3 | 835.0 | opposite-strand | DeoR-like helix-turn-helix domain |
| 7 | PF00563.22 | 1.0 | 3 | -44.0 | opposite-strand | EAL domain |
| 8 | PF00990.23 | 0.67 | 2 | -44 | opposite-strand | Diguanylate cyclase, GGDEF domain |
| 9 | PF00773.21 | 0.67 | 2 | 1752 | opposite-strand | RNB domain |
| 10 | PF08206.13 | 0.67 | 2 | 1752 | opposite-strand | Ribonuclease B OB domain |
| 11 | PF00575.25 | 0.67 | 2 | 1752 | opposite-strand | S1 RNA binding domain |
| 12 | PF17876.3 | 0.67 | 2 | 1752 | opposite-strand | Cold shock domain |
| 13 | PF13561.8 | 0.67 | 2 | 5025 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
| 14 | PF00106.27 | 0.67 | 2 | 5025 | opposite-strand | short chain dehydrogenase |
++ More..