Result : EXP00753

Protein Information

• Protein name: EXP00753
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 301869
• Right: 301958
• Strand: +
• Nucleotide Sequence: ATCTTCTTGATAGTGATGTGGGATGTTATACGTATGGCATCGCTGATGTTTATGGTTACCCCTTATGTGTGCTCAGGAATCGACAGGTAA
• Sequence: IFLIVMWDVIRMASLMFMVTPYVCSGIDR
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 29

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	332256	332330	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	969029	969112	+	NZ_LR134340.1	Escherichia marmotae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00563.22	1.0	2	41.5	same-strand	EAL domain
2	PF00196.21	1.0	2	41.5	same-strand	Bacterial regulatory proteins, luxR family
3	PF03466.22	1.0	2	1171.5	opposite-strand	LysR substrate binding domain
4	PF00126.29	1.0	2	1171.5	opposite-strand	Bacterial regulatory helix-turn-helix protein, lysR family
5	PF06496.13	1.0	2	2195.5	opposite-strand	Protein of unknown function (DUF1097)
6	PF13637.8	1.0	2	2950.5	same-strand	Ankyrin repeats (many copies)
7	PF12796.9	1.0	2	2950.5	same-strand	Ankyrin repeats (3 copies)
8	PF11392.10	1.0	2	3595.5	same-strand	Protein of unknown function (DUF2877)