Result : EXP00752

Protein Information

• Protein name: EXP00752
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 3787076
• Right: 3787138
• Strand: +
• Nucleotide Sequence: TTGAGTATGATGAAGAGGACGAATTTGCCGGTATTAAGAACACATATCCTGATGAAATGCTGA
• Sequence: LSMMKRTNLPVLRTHILMKC
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 20

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3898272	3898334	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	3850307	3850369	-	NC_004337.2	Shigella flexneri 2a str. 301
3	3872473	3872535	+	NZ_AP014857.1	Escherichia albertii

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF03358.17	0.67	2	2861.5	same-strand	NADPH-dependent FMN reductase
2	PF00860.22	0.67	2	1469.5	opposite-strand	Permease family
3	PF13419.8	1.0	3	833	same-strand	Haloacid dehalogenase-like hydrolase
4	PF00702.28	1.0	3	833	same-strand	haloacid dehalogenase-like hydrolase
5	PF03691.16	0.67	2	-62.0	same-strand	Uncharacterised protein family (UPF0167)
6	PF01182.22	0.67	2	337.0	opposite-strand	Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase
7	PF02264.17	0.67	2	2266.5	opposite-strand	LamB porin
8	PF11471.10	0.67	2	2266.5	opposite-strand	Maltoporin periplasmic N-terminal extension