Result : EXP00751
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00751 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 198446 |
| Right | 198526 |
| Strand | + |
| Nucleotide Sequence | ATGCCTTTGCTAATCGAGAGCGTCGTTTCGGCGGCACCGAGCCCGGTGATGAAACAGCCTGATGGGGGTCGCTTTTGCTGA |
| Sequence | MPLLIESVVSAAPSPVMKQPDGGRFC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 53
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 198948 | 199028 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 200323 | 200403 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 195603 | 195683 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 186547 | 186627 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 3418369 | 3418449 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 2419251 | 2419331 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 7 | 210936 | 211016 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 819843 | 819923 | + | NZ_LR134340.1 | Escherichia marmotae |
| 9 | 3750867 | 3750947 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 10 | 3653470 | 3653550 | + | NZ_CP033744.1 | Citrobacter freundii |
| 11 | 4702801 | 4702881 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 12 | 2476863 | 2476943 | - | NZ_CP038469.1 | Citrobacter tructae |
| 13 | 2958706 | 2958786 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 14 | 1404511 | 1404591 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 15 | 2847284 | 2847364 | + | NZ_CP053416.1 | Salmonella bongori |
| 16 | 1990082 | 1990162 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 17 | 260053 | 260133 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 18 | 910777 | 910857 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 19 | 680729 | 680809 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 20 | 4406919 | 4406999 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 21 | 2197421 | 2197501 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 22 | 4633409 | 4633489 | - | NZ_CP050508.1 | Raoultella terrigena |
| 23 | 868406 | 868486 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 24 | 3664134 | 3664214 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 25 | 4939084 | 4939164 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 26 | 3992236 | 3992316 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 27 | 4519065 | 4519145 | - | NZ_CP054254.1 | Klebsiella variicola |
| 28 | 973983 | 974063 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 29 | 4245238 | 4245318 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 30 | 4859138 | 4859218 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 31 | 4519957 | 4520037 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 32 | 2715384 | 2715464 | + | NZ_CP026047.1 | Raoultella planticola |
| 33 | 997427 | 997507 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 34 | 836838 | 836918 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 35 | 3391512 | 3391592 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 36 | 881473 | 881553 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 37 | 4318138 | 4318218 | - | NZ_CP041247.1 | Raoultella electrica |
| 38 | 851041 | 851121 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 39 | 837974 | 838054 | + | NC_015968.1 | Enterobacter soli |
| 40 | 1664135 | 1664215 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 41 | 4974102 | 4974182 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 42 | 897509 | 897589 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 43 | 2176003 | 2176083 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 44 | 3750710 | 3750790 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 45 | 2672132 | 2672212 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 46 | 3734419 | 3734499 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 47 | 3920282 | 3920362 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 48 | 2183938 | 2184018 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 49 | 4274965 | 4275045 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 50 | 4205665 | 4205748 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 51 | 3654140 | 3654220 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 52 | 2546002 | 2546082 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 53 | 880137 | 880217 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 54 | 3788330 | 3788410 | - | NZ_CP035129.1 | Kosakonia cowanii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP014857.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00889.21 | 1.0 | 53 | 3817.5 | same-strand | Elongation factor TS |
| 2 | PF00696.30 | 1.0 | 53 | 2941.0 | same-strand | Amino acid kinase family |
| 3 | PF01765.21 | 1.0 | 53 | 2180.0 | same-strand | Ribosome recycling factor |
| 4 | PF02670.18 | 1.0 | 53 | 886.0 | same-strand | 1-deoxy-D-xylulose 5-phosphate reductoisomerase |
| 5 | PF13288.8 | 1.0 | 53 | 886.0 | same-strand | DXP reductoisomerase C-terminal domain |
| 6 | PF08436.14 | 1.0 | 53 | 886.0 | same-strand | 1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal domain |
| 7 | PF01255.21 | 0.98 | 52 | -61 | same-strand | Putative undecaprenyl diphosphate synthase |
| 8 | PF01148.22 | 0.98 | 52 | -6 | same-strand | Cytidylyltransferase family |
| 9 | PF02163.24 | 1.0 | 53 | 863.0 | same-strand | Peptidase family M50 |
| 10 | PF17820.3 | 1.0 | 53 | 863.0 | same-strand | PDZ domain |
| 11 | PF00595.26 | 0.64 | 34 | 863 | same-strand | PDZ domain |
| 12 | PF13180.8 | 1.0 | 53 | 863.0 | same-strand | PDZ domain |
| 13 | PF01103.25 | 1.0 | 53 | 2247.0 | same-strand | Omp85 superfamily domain |
| 14 | PF07244.17 | 1.0 | 53 | 2247.0 | same-strand | Surface antigen variable number repeat |
| 15 | PF03938.16 | 1.0 | 53 | 4787.0 | same-strand | Outer membrane protein (OmpH-like) |
| 16 | PF00132.26 | 0.96 | 51 | 5285 | same-strand | Bacterial transferase hexapeptide (six repeats) |
| 17 | PF04613.16 | 0.94 | 50 | 5284.5 | same-strand | UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase, LpxD |
| 18 | PF14602.8 | 0.96 | 51 | 5285 | same-strand | Hexapeptide repeat of succinyl-transferase |
++ More..