Result : EXP00750
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00750 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 116049 |
| Right | 116093 |
| Strand | + |
| Nucleotide Sequence | ATGATTATCAAAACGTTAAAAATGAGTGCACGAAAGCGAAATTGA |
| Sequence | MIIKTLKMSARKRN |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed in both exponential and stationary phase; expression is considerably higher during stationary phase (at protein level) Pubmed:29645342 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DPM6 |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 117734 | 117778 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 113244 | 113288 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3480850 | 3480894 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 735491 | 735535 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07517.16 | 1.0 | 3 | 2177.0 | same-strand | SecA DEAD-like domain |
| 2 | PF07516.15 | 1.0 | 3 | 2177.0 | same-strand | SecA Wing and Scaffold domain |
| 3 | PF01043.22 | 1.0 | 3 | 2177.0 | same-strand | SecA preprotein cross-linking domain |
| 4 | PF02810.17 | 1.0 | 3 | 2177.0 | same-strand | SEC-C motif |
| 5 | PF00293.30 | 1.0 | 3 | 1723.5 | same-strand | NUDIX domain |
| 6 | PF14815.8 | 1.0 | 3 | 1723.5 | same-strand | NUDIX domain |
| 7 | PF03884.16 | 1.0 | 3 | 1398.0 | opposite-strand | DNA gyrase inhibitor YacG |
| 8 | PF07072.13 | 1.0 | 3 | 645.0 | opposite-strand | Cell division protein |
| 9 | PF01121.22 | 1.0 | 3 | 25.0 | opposite-strand | Dephospho-CoA kinase |
| 10 | PF13671.8 | 1.0 | 3 | 25.0 | opposite-strand | AAA domain |
| 11 | PF13238.8 | 1.0 | 3 | 25.0 | opposite-strand | AAA domain |
| 12 | PF13207.8 | 0.67 | 2 | 25 | opposite-strand | AAA domain |
| 13 | PF00478.27 | 1.0 | 3 | 156.0 | same-strand | IMP dehydrogenase / GMP reductase domain |
| 14 | PF00482.25 | 1.0 | 3 | 1234.0 | opposite-strand | Type II secretion system (T2SS), protein F |
| 15 | PF00437.22 | 1.0 | 3 | 2426.0 | opposite-strand | Type II/IV secretion system protein |
| 16 | PF07963.14 | 1.0 | 3 | 3821.0 | opposite-strand | Prokaryotic N-terminal methylation motif |
| 17 | PF01729.21 | 0.67 | 2 | 4464 | opposite-strand | Quinolinate phosphoribosyl transferase, C-terminal domain |
| 18 | PF02749.18 | 0.67 | 2 | 4464 | opposite-strand | Quinolinate phosphoribosyl transferase, N-terminal domain |
++ More..