Result : EXP00744
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00744 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4306235 |
| Right | 4306318 |
| Strand | + |
| Nucleotide Sequence | TTGCGGCAGCAAGGATTCATCCAAATGATCCACAAAGGCTTTCCCGGGCACTGGAAGTTTTTTTCATTTCGGGTAAAACTTTAA |
| Sequence | LRQQGFIQMIHKGFPGHWKFFSFRVKL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 77
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 425838 | 425921 | + | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 5253567 | 5253650 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 3320196 | 3320279 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 4438504 | 4438587 | + | NZ_AP014857.1 | Escherichia albertii |
| 5 | 4399715 | 4399798 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 6 | 4504533 | 4504616 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 7 | 3851278 | 3851361 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 8 | 3612385 | 3612468 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 9 | 2676031 | 2676114 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 10 | 465171 | 465254 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 11 | 180744 | 180827 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 12 | 4899720 | 4899803 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 13 | 421973 | 422056 | + | NC_015968.1 | Enterobacter soli |
| 14 | 3101508 | 3101591 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 15 | 440027 | 440110 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 16 | 532073 | 532156 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 17 | 3412998 | 3413081 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 18 | 3512352 | 3512435 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 19 | 2961322 | 2961405 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 20 | 4399643 | 4399726 | - | NZ_CP023525.1 | Cedecea neteri |
| 21 | 4108089 | 4108172 | - | NZ_LR134201.1 | Cedecea lapagei |
| 22 | 429281 | 429364 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 23 | 3895775 | 3895858 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 24 | 2169336 | 2169419 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 25 | 4391518 | 4391601 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 26 | 442863 | 442946 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 27 | 416457 | 416540 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 28 | 596850 | 596933 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 29 | 4126922 | 4127005 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 30 | 4825404 | 4825487 | - | NZ_CP041247.1 | Raoultella electrica |
| 31 | 5117647 | 5117730 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 32 | 2200628 | 2200711 | + | NZ_CP026047.1 | Raoultella planticola |
| 33 | 4604021 | 4604104 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 34 | 1068859 | 1068942 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 35 | 2383067 | 2383150 | + | NZ_CP053416.1 | Salmonella bongori |
| 36 | 5535812 | 5535895 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 37 | 1437538 | 1437621 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 38 | 1715604 | 1715696 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 39 | 5530203 | 5530286 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 40 | 4212736 | 4212819 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 41 | 3262860 | 3262943 | - | NZ_CP034035.1 | Brenneria rubrifaciens |
| 42 | 4747003 | 4747071 | - | NC_012962.1 | Photorhabdus asymbiotica |
| 43 | 4108361 | 4108444 | + | NZ_CP067057.1 | Rahnella aceris |
| 44 | 566979 | 567071 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 45 | 290225 | 290308 | - | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 46 | 2474047 | 2474115 | - | NZ_CP014035.2 | Vibrio fluvialis |
| 47 | 3949707 | 3949790 | - | NZ_LT615367.1 | Dickeya aquatica |
| 48 | 634943 | 635026 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 49 | 5347903 | 5347971 | - | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
| 50 | 387853 | 387936 | + | NZ_CP065534.1 | Lonsdalea populi |
| 51 | 404745 | 404837 | + | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 52 | 4017281 | 4017364 | - | NZ_CP006569.1 | Sodalis praecaptivus |
| 53 | 536009 | 536101 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 54 | 2360324 | 2360416 | - | NZ_CP049115.1 | Pantoea stewartii |
| 55 | 330618 | 330701 | + | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
| 56 | 3335860 | 3335943 | - | NZ_LN907827.1 | Erwinia gerundensis |
| 57 | 546207 | 546290 | + | NZ_CP038853.1 | Pantoea vagans |
| 58 | 536138 | 536221 | + | NZ_CP045720.1 | Pantoea eucalypti |
| 59 | 3535186 | 3535269 | - | NZ_CP034148.1 | Pantoea agglomerans |
| 60 | 246608 | 246676 | + | NZ_AP014524.1 | Vibrio cholerae MS6 |
| 61 | 511553 | 511636 | + | NZ_CP043727.1 | Yersinia canariae |
| 62 | 3158996 | 3159079 | + | NZ_CP009781.1 | Yersinia aldovae 670-83 |
| 63 | 4227168 | 4227251 | - | NZ_CP011118.1 | Yersinia enterocolitica |
| 64 | 2112555 | 2112632 | + | NZ_CP019706.1 | Pantoea alhagi |
| 65 | 3308325 | 3308408 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 66 | 3247440 | 3247523 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 67 | 3977752 | 3977835 | - | NZ_CP026377.1 | Mixta gaviniae |
| 68 | 3755071 | 3755154 | - | NZ_CP061511.1 | Mixta calida |
| 69 | 272658 | 272750 | + | NZ_CP033078.1 | Vibrio zhugei |
| 70 | 2800256 | 2800324 | - | NZ_CP047475.1 | Vibrio astriarenae |
| 71 | 649864 | 649947 | - | NZ_CP023009.1 | Lonsdalea britannica |
| 72 | 3123961 | 3124053 | - | NZ_CP028271.1 | Mixta intestinalis |
| 73 | 3158899 | 3158991 | + | NZ_CP009977.1 | Vibrio natriegens NBRC 15636 = ATCC 14048 = DSM 759 |
| 74 | 3220196 | 3220288 | - | NZ_CP071325.1 | Photobacterium ganghwense |
| 75 | 2067262 | 2067345 | - | NZ_CP014136.1 | Gibbsiella quercinecans |
| 76 | 710151 | 710243 | + | NC_013456.1 | Vibrio antiquarius |
| 77 | 539904 | 539987 | + | NC_014306.1 | Erwinia billingiae Eb661 |
| 78 | 2303924 | 2303992 | - | NC_007517.1 | Geobacter metallireducens GS-15 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01256.19 | 0.86 | 66 | 4135 | same-strand | Carbohydrate kinase |
| 2 | PF03853.17 | 0.86 | 66 | 4135 | same-strand | YjeF-related protein N-terminus |
| 3 | PF02367.19 | 0.99 | 76 | 3704 | same-strand | Threonylcarbamoyl adenosine biosynthesis protein TsaE |
| 4 | PF01520.20 | 0.99 | 76 | 2335 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 5 | PF01119.21 | 1.0 | 77 | 456.0 | same-strand | DNA mismatch repair protein, C-terminal domain |
| 6 | PF08676.13 | 1.0 | 77 | 456.0 | same-strand | MutL C terminal dimerisation domain |
| 7 | PF01715.19 | 1.0 | 77 | -83.0 | same-strand | IPP transferase |
| 8 | PF17209.5 | 1.0 | 77 | 506.0 | same-strand | Hfq protein |
| 9 | PF13167.8 | 0.99 | 76 | 894 | same-strand | GTP-binding GTPase N-terminal |
| 10 | PF16360.7 | 0.99 | 76 | 894 | same-strand | GTP-binding GTPase Middle Region |
| 11 | PF01926.25 | 0.99 | 76 | 894 | same-strand | 50S ribosome-binding GTPase |
| 12 | PF02421.20 | 0.99 | 76 | 894 | same-strand | Ferrous iron transport protein B |
| 13 | PF01145.27 | 0.99 | 76 | 2902.5 | same-strand | SPFH domain / Band 7 family |
| 14 | PF12221.10 | 0.99 | 76 | 2255 | same-strand | Bacterial membrane protein N terminal |
++ More..