Result : B1ZCM6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division topological specificity factor |
| NCBI Accession ID | CP001029.1 |
| Organism | Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001) (Methylobacterium populi) |
| Left | 1306052 |
| Right | 1306348 |
| Strand | + |
| Nucleotide Sequence | ATGAGCGTTCTGACCTTCCTCAAACCGCGCGGGTCGAGTTCCGTCGCCCGCGAGCGCCTGCAGCTGATCCTGGCACACGAGCGCGCGGAGCGTTCGGAGACGGGTCGGCCCGACCTGATCATCACCCTGCGCGAAGAGATCCTGAACGTGATCGCCAAGCACGTGACGGTCGAGCGCGACAAGGTGCAGATCAAGCTGGAGCGCGGCGAGGGCGTCTCGACGCTCGGCGTCGACATCGAGTTCCCCGTCGACGCGATCTCGAAGGCCAAGCCGAAGGCCAAGCGCGCCATCGCCTGA |
| Sequence | MSVLTFLKPRGSSSVARERLQLILAHERAERSETGRPDLIITLREEILNVIAKHVTVERDKVQIKLERGEGVSTLGVDIEFPVDAISKAKPKAKRAIA |
| Source of smORF | Swiss-Prot |
| Function | Prevents the cell division inhibition by proteins MinC and MinD at internal division sites while permitting inhibition at polar sites. This ensures cell division at the proper site by restricting the formation of a division septum at the midpoint of the long axis of the cell. {ECO:0000255|HAMAP-Rule:MF_00262}. |
| Pubmed ID | |
| Domain | CDD:412433 |
| Functional Category | Others |
| Uniprot ID | B1ZCM6 |
| ORF Length (Amino Acid) | 98 |
++ More..
| Conservation Analysis |
No. of Species: 64
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1321273 | 1321569 | + | NZ_CP039546.1 | Methylorubrum populi |
| 2 | 2959241 | 2959546 | + | NZ_CP029550.1 | Methylobacterium durans |
| 3 | 1730048 | 1730317 | + | NZ_CP029550.1 | Methylobacterium durans |
| 4 | 1697889 | 1698158 | + | NZ_CP029550.1 | Methylobacterium durans |
| 5 | 699025 | 699288 | + | NZ_CP041241.1 | Ensifer mexicanus |
| 6 | 5037708 | 5037977 | - | NZ_CP029553.1 | Methylobacterium terrae |
| 7 | 2348077 | 2348337 | + | NZ_CP029553.1 | Methylobacterium terrae |
| 8 | 2973311 | 2973595 | + | NC_011894.1 | Methylobacterium nodulans ORS 2060 |
| 9 | 5600194 | 5600463 | + | NC_011894.1 | Methylobacterium nodulans ORS 2060 |
| 10 | 1444848 | 1445108 | - | NZ_CP013110.1 | Sinorhizobium americanum |
| 11 | 364803 | 365063 | + | NZ_CP023068.1 | Ensifer sojae CCBAU 05684 |
| 12 | 1923869 | 1924153 | - | NC_010581.1 | Beijerinckia indica subsp. indica ATCC 9039 |
| 13 | 1611122 | 1611385 | - | NZ_CP029452.1 | Sinorhizobium fredii CCBAU 25509 |
| 14 | 1446114 | 1446377 | - | NC_020560.1 | Sinorhizobium meliloti 2011 |
| 15 | 17838 | 18098 | - | NZ_CP034910.1 | Ensifer alkalisoli |
| 16 | 1386444 | 1386725 | - | NZ_CP016616.1 | Microvirga ossetica |
| 17 | 2361971 | 2362240 | - | NZ_CP016616.1 | Microvirga ossetica |
| 18 | 3178559 | 3178831 | + | NC_019973.1 | Mesorhizobium australicum WSM2073 |
| 19 | 866970 | 867242 | - | NC_007624.1 | Brucella abortus 2308 |
| 20 | 948430 | 948702 | - | NC_022906.1 | Brucella ceti TE10759-12 |
| 21 | 303619 | 303891 | + | NC_009504.1 | Brucella ovis ATCC 25840 |
| 22 | 965984 | 966256 | - | NC_003318.1 | Brucella melitensis bv. 1 str. 16M |
| 23 | 304496 | 304768 | + | NC_010104.1 | Brucella canis ATCC 23365 |
| 24 | 304382 | 304654 | + | NC_004311.2 | Brucella suis 1330 |
| 25 | 305666 | 305938 | + | NC_013118.1 | Brucella microti CCM 4915 |
| 26 | 202193 | 202465 | + | NZ_LT605586.1 | Brucella inopinata |
| 27 | 1987626 | 1987907 | + | NZ_CP014689.1 | Gluconobacter albidus |
| 28 | 1585629 | 1585898 | - | NZ_CP064062.1 | Brucella anthropi |
| 29 | 696960 | 697232 | - | NZ_CP050296.1 | Mesorhizobium huakuii |
| 30 | 1605044 | 1605316 | - | NC_002678.2 | Mesorhizobium japonicum MAFF 303099 |
| 31 | 3445879 | 3446151 | + | NZ_CP033507.1 | Mesorhizobium jarvisii |
| 32 | 1471458 | 1471718 | - | NC_020062.1 | Rhizobium tropici CIAT 899 |
| 33 | 3066841 | 3067113 | + | NZ_CP015318.1 | Mesorhizobium amorphae CCNWGS0123 |
| 34 | 3348422 | 3348694 | + | NC_015675.1 | Mesorhizobium opportunistum WSM2075 |
| 35 | 2898270 | 2898542 | + | NZ_CP033361.1 | Mesorhizobium erdmanii |
| 36 | 1205987 | 1206262 | + | NC_020453.1 | Bradyrhizobium oligotrophicum S58 |
| 37 | 448060 | 448338 | + | NZ_CP004373.1 | Gluconobacter oxydans DSM 3504 |
| 38 | 2867610 | 2867885 | + | NZ_CP022219.1 | Bradyrhizobium guangxiense |
| 39 | 3741175 | 3741435 | - | NZ_LR723670.1 | Pseudorhizobium flavum |
| 40 | 3758496 | 3758756 | - | NZ_FO082820.1 | Pseudorhizobium banfieldiae |
| 41 | 1313794 | 1314054 | - | NZ_CP059897.1 | Ciceribacter thiooxidans |
| 42 | 4588175 | 4588450 | + | NZ_CP032617.1 | Bradyrhizobium diazoefficiens |
| 43 | 5172575 | 5172841 | + | NZ_CP039690.1 | Phreatobacter stygius |
| 44 | 2463351 | 2463614 | - | NC_015186.1 | Acidiphilium multivorum AIU301 |
| 45 | 496469 | 496747 | + | NZ_CP068419.1 | Gluconobacter sphaericus |
| 46 | 6216017 | 6216292 | - | NZ_CP050066.1 | Bradyrhizobium symbiodeficiens |
| 47 | 4434605 | 4434880 | - | NZ_LS398110.1 | Bradyrhizobium vignae |
| 48 | 391360 | 391641 | + | NZ_CP032485.1 | Neokomagataea tanensis |
| 49 | 319426 | 319707 | + | NZ_CP043043.1 | Gluconobacter thailandicus |
| 50 | 2087223 | 2087492 | - | NZ_CP018171.1 | Mesorhizobium oceanicum |
| 51 | 2996938 | 2997213 | + | NZ_CP029426.1 | Bradyrhizobium amphicarpaeae |
| 52 | 7518269 | 7518559 | - | NZ_CP042968.1 | Bradyrhizobium paxllaeri |
| 53 | 4141401 | 4141682 | - | NC_017082.1 | Bradyrhizobium cosmicum |
| 54 | 3695251 | 3695526 | + | NZ_CP030051.1 | Bradyrhizobium guangdongense |
| 55 | 2872990 | 2873256 | + | NZ_CP032509.1 | Georhizobium profundi |
| 56 | 4895474 | 4895749 | + | NZ_CP030050.1 | Bradyrhizobium arachidis |
| 57 | 5538404 | 5538679 | - | NZ_CP022221.1 | Bradyrhizobium zhanjiangense |
| 58 | 4093787 | 4094062 | - | NZ_CP030053.1 | Bradyrhizobium guangzhouense |
| 59 | 959908 | 960237 | - | NZ_CP042808.1 | Acetobacter oryzoeni |
| 60 | 127663 | 127938 | - | NZ_CP044543.1 | Bradyrhizobium betae |
| 61 | 3066181 | 3066444 | - | NC_011144.1 | Phenylobacterium zucineum HLK1 |
| 62 | 1321432 | 1321695 | - | NZ_CP024201.1 | Caulobacter mirabilis |
| 63 | 1787741 | 1788025 | + | NZ_CP014681.1 | Kozakia baliensis |
| 64 | 6844412 | 6844687 | - | NZ_CP029425.1 | Bradyrhizobium ottawaense |
| 65 | 4422008 | 4422283 | + | NZ_CP058354.1 | Bradyrhizobium japonicum |
| 66 | 4093427 | 4093699 | - | NZ_CP015064.1 | Mesorhizobium ciceri biovar biserrulae |
| 67 | 545392 | 545646 | + | NZ_CP003182.2 | Granulibacter bethesdensis CGDNIH4 |
| 68 | 607468 | 607719 | - | NZ_CP054836.1 | Oricola thermophila |
| 69 | 3007938 | 3008222 | + | NZ_CP062147.1 | Komagataeibacter hansenii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP029550.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03775.18 | 0.98 | 63 | 844.5 | same-strand | Septum formation inhibitor MinC, C-terminal domain |
| 2 | PF01656.25 | 1.0 | 64 | -3 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
| 3 | PF13614.8 | 0.98 | 63 | -3.0 | same-strand | AAA domain |
| 4 | PF10609.11 | 0.91 | 58 | -3.0 | same-strand | NUBPL iron-transfer P-loop NTPase |
++ More..