Result : EXP00733
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00733 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1589027 |
| Right | 1589080 |
| Strand | + |
| Nucleotide Sequence | ATGAACTATTATGGGTTAAACAATAAAATCCCCACCCGAAATGATACTTATTAG |
| Sequence | MNYYGLNNKIPTRNDTY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1854378 | 1854431 | - | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 1766801 | 1766854 | + | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07102.14 | 1.0 | 2 | 1087.0 | opposite-strand | Protein of unknown function (DUF1364) |
| 2 | PF05866.13 | 1.0 | 2 | 728.0 | opposite-strand | Endodeoxyribonuclease RusA |
| 3 | PF06530.14 | 1.0 | 2 | 128.0 | opposite-strand | Phage antitermination protein Q |
| 4 | PF08212.14 | 1.0 | 2 | -25.0 | same-strand | Lipocalin-like domain |
| 5 | PF00061.25 | 1.0 | 2 | -25.0 | same-strand | Lipocalin / cytosolic fatty-acid binding protein family |
| 6 | PF08349.13 | 1.0 | 2 | 692.0 | opposite-strand | Protein of unknown function (DUF1722) |
| 7 | PF04463.14 | 1.0 | 2 | 692.0 | opposite-strand | 2-thiouracil desulfurase |
| 8 | PF12833.9 | 1.0 | 2 | 2002.0 | opposite-strand | Helix-turn-helix domain |
| 9 | PF04971.14 | 1.0 | 2 | 2922.0 | opposite-strand | Bacteriophage P21 holin S |
| 10 | PF16080.7 | 1.0 | 2 | 2922.0 | opposite-strand | Bacteriophage holin family HP1 |
| 11 | PF00959.21 | 1.0 | 2 | 3137.0 | opposite-strand | Phage lysozyme |
++ More..