Result : EXP00728
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00728 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2592526 |
| Right | 2592588 |
| Strand | + |
| Nucleotide Sequence | ATGGAAGTAGGCAAGTTGGGGAAACCGTATCCGTTGCTGAATCTGGCATATGTGGGAGTATAA |
| Sequence | MEVGKLGKPYPLLNLAYVGV |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed equally in exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG1 |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3446258 | 3446320 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 5022207 | 5022263 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 2725925 | 2725987 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 4213680 | 4213736 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 985493 | 985555 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 3921939 | 3921995 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 2722966 | 2723028 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 8 | 4047140 | 4047202 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 9 | 3155374 | 3155430 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 10 | 3244789 | 3244851 | + | NZ_LR134340.1 | Escherichia marmotae |
| 11 | 4184816 | 4184872 | - | NZ_AP014857.1 | Escherichia albertii |
| 12 | 3930170 | 3930220 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 13 | 1196001 | 1196075 | + | NC_008783.1 | Bartonella bacilliformis KC583 |
| 14 | 1198940 | 1198999 | - | NZ_CP043575.1 | Comamonas koreensis |
| 15 | 2980030 | 2980080 | - | NZ_CP033744.1 | Citrobacter freundii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00004.31 | 0.7 | 7 | 7060.0 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 2 | PF07728.16 | 0.7 | 7 | 7060.0 | opposite-strand | AAA domain (dynein-related subfamily) |
| 3 | PF00158.28 | 0.6 | 6 | 8636.0 | opposite-strand | Sigma-54 interaction domain |
| 4 | PF04204.18 | 0.6 | 6 | 544 | opposite-strand | Homoserine O-succinyltransferase |
++ More..