Result : EXP00725
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00725 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 927492 |
| Right | 927557 |
| Strand | + |
| Nucleotide Sequence | ATGTCGCTGATGCCAACGATAGATGATAGTTATCTATCATGTGGAGTAGATTGGTCAGGCAAATAA |
| Sequence | MSLMPTIDDSYLSCGVDWSGK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1053865 | 1053930 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 922789 | 922854 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 874102 | 874167 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1419593 | 1419658 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 947990 | 948055 | + | NZ_AP014857.1 | Escherichia albertii |
| 6 | 1571762 | 1571827 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 3915247 | 3915300 | - | NZ_CP045205.1 | Citrobacter telavivensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF11398.10 | 1.0 | 6 | 4658 | same-strand | Protein of unknown function (DUF2813) |
| 2 | PF04393.15 | 1.0 | 6 | 3669 | opposite-strand | Protein of unknown function (DUF535) |
| 3 | PF16576.7 | 1.0 | 6 | 2439 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
| 4 | PF13437.8 | 1.0 | 6 | 2439 | same-strand | HlyD family secretion protein |
| 5 | PF13533.8 | 1.0 | 6 | 2439 | same-strand | Biotin-lipoyl like |
| 6 | PF12704.9 | 1.0 | 6 | 496 | same-strand | MacB-like periplasmic core domain |
| 7 | PF00005.29 | 1.0 | 6 | 496.5 | same-strand | ABC transporter |
| 8 | PF02687.23 | 1.0 | 6 | 496 | same-strand | FtsX-like permease family |
| 9 | PF02463.21 | 0.67 | 4 | 496 | same-strand | RecF/RecN/SMC N terminal domain |
| 10 | PF00313.24 | 1.0 | 6 | 199 | opposite-strand | 'Cold-shock' DNA-binding domain |
| 11 | PF02617.19 | 1.0 | 6 | 59 | same-strand | ATP-dependent Clp protease adaptor protein ClpS |
| 12 | PF07724.16 | 1.0 | 6 | 410 | same-strand | AAA domain (Cdc48 subfamily) |
| 13 | PF17871.3 | 1.0 | 6 | 410 | same-strand | AAA lid domain |
| 14 | PF10431.11 | 1.0 | 6 | 410 | same-strand | C-terminal, D2-small domain, of ClpB protein |
| 15 | PF00004.31 | 1.0 | 6 | 410 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 16 | PF07728.16 | 1.0 | 6 | 410 | same-strand | AAA domain (dynein-related subfamily) |
| 17 | PF02861.22 | 1.0 | 6 | 410 | same-strand | Clp amino terminal domain, pathogenicity island component |
| 18 | PF00158.28 | 0.67 | 4 | 410 | same-strand | Sigma-54 interaction domain |
| 19 | PF05621.13 | 1.0 | 6 | 410 | same-strand | Bacterial TniB protein |
| 20 | PF01176.21 | 0.67 | 4 | 3373 | opposite-strand | Translation initiation factor 1A / IF-1 |
| 21 | PF03588.16 | 0.67 | 4 | 3876 | opposite-strand | Leucyl/phenylalanyl-tRNA protein transferase |
| 22 | PF00664.25 | 0.67 | 4 | 4622 | opposite-strand | ABC transporter transmembrane region |
| 23 | PF13401.8 | 0.67 | 4 | 4622 | opposite-strand | AAA domain |
| 24 | PF13191.8 | 0.67 | 4 | 4622 | opposite-strand | AAA ATPase domain |
++ More..