Result : EXP00723
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00723 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3222795 |
| Right | 3222848 |
| Strand | + |
| Nucleotide Sequence | ATGCTGGTTTTCTCGTCAGTTCAAGGCAGGATAAGGGTTAACACGCCTTTATGA |
| Sequence | MLVFSSVQGRIRVNTPL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4096775 | 4096828 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3346461 | 3346514 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 462525 | 462575 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 3354295 | 3354348 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10707.11 | 1.0 | 3 | 5210.5 | same-strand | PhoP regulatory network protein YrbL |
| 2 | PF00912.24 | 0.67 | 2 | 4486 | opposite-strand | Transglycosylase |
| 3 | PF02518.28 | 1.0 | 3 | 1270.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 4 | PF18415.3 | 1.0 | 3 | 1270.0 | opposite-strand | Histidine kinase receptor ArcB trans-membrane domain |
| 5 | PF00072.26 | 1.0 | 3 | 1270.0 | opposite-strand | Response regulator receiver domain |
| 6 | PF00989.27 | 1.0 | 3 | 1270.0 | opposite-strand | PAS fold |
| 7 | PF00512.27 | 1.0 | 3 | 1270.0 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 8 | PF08448.12 | 1.0 | 3 | 1270.0 | opposite-strand | PAS fold |
| 9 | PF01627.25 | 1.0 | 3 | 1270.0 | opposite-strand | Hpt domain |
| 10 | PF13426.9 | 1.0 | 3 | 1270.0 | opposite-strand | PAS domain |
| 11 | PF16199.7 | 1.0 | 3 | 245.0 | opposite-strand | Radical SAM C-terminal domain |
| 12 | PF04055.23 | 1.0 | 3 | 245.0 | opposite-strand | Radical SAM superfamily |
| 13 | PF00310.23 | 1.0 | 3 | 284.0 | same-strand | Glutamine amidotransferases class-II |
| 14 | PF01645.19 | 1.0 | 3 | 284.0 | same-strand | Conserved region in glutamate synthase |
| 15 | PF04898.16 | 1.0 | 3 | 284.0 | same-strand | Glutamate synthase central domain |
| 16 | PF01493.21 | 1.0 | 3 | 284.0 | same-strand | GXGXG motif |
| 17 | PF14691.8 | 1.0 | 3 | 4850.0 | same-strand | Dihydroprymidine dehydrogenase domain II, 4Fe-4S cluster |
| 18 | PF07992.16 | 1.0 | 3 | 4850.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 19 | PF00070.29 | 1.0 | 3 | 4850.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 20 | PF06250.13 | 0.67 | 2 | 6453.0 | same-strand | YhcG PDDEXK nuclease domain |
| 21 | PF17761.3 | 0.67 | 2 | 6453.0 | same-strand | DUF1016 N-terminal domain |
| 22 | PF04074.14 | 0.67 | 2 | 7601.0 | opposite-strand | YhcH/YjgK/YiaL |
| 23 | PF00480.22 | 0.67 | 2 | 8062.0 | opposite-strand | ROK family |
++ More..