Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00722 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 1868027 |
Right | 1868095 |
Strand | + |
Nucleotide Sequence | GTGATTTTTAATTATTGCAATTGCACAAGAGTCAGTTCGCCCCCAAAGACAGCACCTGTATCAATATAA |
Sequence | VIFNYCNCTRVSSPPKTAPVSI |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 22 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1922302 | 1922370 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 1795380 | 1795448 | - | NZ_CP061527.1 | Shigella dysenteriae |
3 | 2524270 | 2524338 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
4 | 223914 | 223982 | - | NZ_CP057657.1 | Escherichia fergusonii |
5 | 2995462 | 2995539 | + | NZ_CP015113.1 | Kosakonia radicincitans |
6 | 109717 | 109794 | - | NZ_CP045300.1 | Kosakonia arachidis |
7 | 2211932 | 2212009 | - | NZ_CP014007.2 | Kosakonia oryzae |
8 | 3781927 | 3781995 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
9 | 2553452 | 2553520 | + | NZ_CP011602.1 | Phytobacter ursingii |
10 | 1855230 | 1855298 | + | NZ_AP014857.1 | Escherichia albertii |
11 | 1927757 | 1927825 | - | NZ_LR134340.1 | Escherichia marmotae |
12 | 2775239 | 2775307 | - | NZ_CP045205.1 | Citrobacter telavivensis |
13 | 2743589 | 2743651 | + | NC_015968.1 | Enterobacter soli |
14 | 1867502 | 1867573 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
15 | 882485 | 882562 | - | NZ_CP027107.1 | Cronobacter sakazakii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04403.15 | 1.0 | 14 | 4759 | same-strand | Paraquat-inducible protein A |
2 | PF02470.22 | 1.0 | 14 | 2157 | same-strand | MlaD protein |
3 | PF01189.19 | 1.0 | 14 | 640 | same-strand | 16S rRNA methyltransferase RsmB/F |
4 | PF17125.7 | 1.0 | 14 | 640 | same-strand | N-terminal domain of 16S rRNA methyltransferase RsmF |
5 | PF13636.8 | 1.0 | 14 | 640 | same-strand | RNA-binding PUA-like domain of methyltransferase RsmF |
6 | PF07351.15 | 1.0 | 14 | 286 | same-strand | Protein of unknown function (DUF1480) |
7 | PF07358.13 | 0.86 | 12 | -10 | same-strand | Protein of unknown function (DUF1482) |