Result : EXP00722
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00722 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1868027 |
| Right | 1868095 |
| Strand | + |
| Nucleotide Sequence | GTGATTTTTAATTATTGCAATTGCACAAGAGTCAGTTCGCCCCCAAAGACAGCACCTGTATCAATATAA |
| Sequence | VIFNYCNCTRVSSPPKTAPVSI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1922302 | 1922370 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1795380 | 1795448 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 2524270 | 2524338 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 223914 | 223982 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 2995462 | 2995539 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 6 | 109717 | 109794 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 7 | 2211932 | 2212009 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 8 | 3781927 | 3781995 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 9 | 2553452 | 2553520 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 10 | 1855230 | 1855298 | + | NZ_AP014857.1 | Escherichia albertii |
| 11 | 1927757 | 1927825 | - | NZ_LR134340.1 | Escherichia marmotae |
| 12 | 2775239 | 2775307 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 13 | 2743589 | 2743651 | + | NC_015968.1 | Enterobacter soli |
| 14 | 1867502 | 1867573 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 15 | 882485 | 882562 | - | NZ_CP027107.1 | Cronobacter sakazakii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04403.15 | 1.0 | 14 | 4759 | same-strand | Paraquat-inducible protein A |
| 2 | PF02470.22 | 1.0 | 14 | 2157 | same-strand | MlaD protein |
| 3 | PF01189.19 | 1.0 | 14 | 640 | same-strand | 16S rRNA methyltransferase RsmB/F |
| 4 | PF17125.7 | 1.0 | 14 | 640 | same-strand | N-terminal domain of 16S rRNA methyltransferase RsmF |
| 5 | PF13636.8 | 1.0 | 14 | 640 | same-strand | RNA-binding PUA-like domain of methyltransferase RsmF |
| 6 | PF07351.15 | 1.0 | 14 | 286 | same-strand | Protein of unknown function (DUF1480) |
| 7 | PF07358.13 | 0.86 | 12 | -10 | same-strand | Protein of unknown function (DUF1482) |
++ More..