Result : EXP00720
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00720 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 485118 |
| Right | 485177 |
| Strand | + |
| Nucleotide Sequence | GTGATACGAAGATTCTTAATAACATCAATTTTTCGCTGCGTGCTGGCGAATTTAAGTTAA |
| Sequence | VIRRFLITSIFRCVLANLS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 452291 | 452350 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 1190969 | 1191028 | + | NZ_LR134340.1 | Escherichia marmotae |
| 3 | 535329 | 535388 | + | NZ_AP014857.1 | Escherichia albertii |
| 4 | 4131671 | 4131730 | + | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP014857.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13411.8 | 0.75 | 3 | 1571 | same-strand | MerR HTH family regulatory protein |
| 2 | PF00376.25 | 0.75 | 3 | 1571 | same-strand | MerR family regulatory protein |
| 3 | PF09278.13 | 0.75 | 3 | 1571 | same-strand | MerR, DNA binding |
| 4 | PF01957.20 | 1.0 | 4 | 1112.0 | opposite-strand | NfeD-like C-terminal, partner-binding |
| 5 | PF01145.27 | 1.0 | 4 | 198.0 | opposite-strand | SPFH domain / Band 7 family |
| 6 | PF16200.7 | 1.0 | 4 | 198.0 | opposite-strand | C-terminal region of band 7 |
| 7 | PF00005.29 | 1.0 | 4 | 1821.5 | same-strand | ABC transporter |
| 8 | PF00004.31 | 1.0 | 4 | -59.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 9 | PF03649.15 | 1.0 | 4 | 553.0 | same-strand | Uncharacterised protein family (UPF0014) |
| 10 | PF14561.8 | 1.0 | 4 | 1401.0 | opposite-strand | Tetratricopeptide repeat |
| 11 | PF14559.8 | 1.0 | 4 | 1401.0 | opposite-strand | Tetratricopeptide repeat |
| 12 | PF00085.22 | 1.0 | 4 | 1401.0 | opposite-strand | Thioredoxin |
| 13 | PF00106.27 | 1.0 | 4 | 2316.0 | opposite-strand | short chain dehydrogenase |
| 14 | PF08659.12 | 1.0 | 4 | 2316.0 | opposite-strand | KR domain |
| 15 | PF13460.8 | 1.0 | 4 | 2316.0 | opposite-strand | NAD(P)H-binding |
| 16 | PF13472.8 | 0.75 | 3 | 3121 | opposite-strand | GDSL-like Lipase/Acylhydrolase family |
| 17 | PF00657.24 | 0.75 | 3 | 3121 | opposite-strand | GDSL-like Lipase/Acylhydrolase |
++ More..