Result : EXP00718
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00718 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3782894 |
| Right | 3782956 |
| Strand | + |
| Nucleotide Sequence | GTGATAAAAATTTGCCTTCGTTTTCTATTTCCTATGCCGGGAATATGGTTGGCGTGGCGTTAA |
| Sequence | VIKICLRFLFPMPGIWLAWR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4682932 | 4682994 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3856555 | 3856617 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 4061588 | 4061650 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 3894098 | 3894160 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 4056580 | 4056642 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 6 | 1861646 | 1861708 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 1.0 | 5 | 1308.0 | same-strand | Major Facilitator Superfamily |
| 2 | PF03466.22 | 0.8 | 4 | 374 | same-strand | LysR substrate binding domain |
| 3 | PF00126.29 | 1.0 | 5 | 374.0 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 4 | PF03358.17 | 0.8 | 4 | 492 | same-strand | NADPH-dependent FMN reductase |
| 5 | PF00860.22 | 1.0 | 5 | 1112.0 | opposite-strand | Permease family |
| 6 | PF13419.8 | 0.8 | 4 | 2614 | same-strand | Haloacid dehalogenase-like hydrolase |
| 7 | PF00702.28 | 0.8 | 4 | 2614 | same-strand | haloacid dehalogenase-like hydrolase |
++ More..