Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00712 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 105684 |
Right | 105758 |
Strand | + |
Nucleotide Sequence | ATCTCTCTGATGAGACACAGTATTTCTGCCCCGCAGGTCTGGAAGCGTCACAAGAGGCCAATTTGCAGGCATTAG |
Sequence | ISLMRHSISAPQVWKRHKRPICRH |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 107494 | 107559 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 102888 | 102953 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 101506 | 101571 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 725184 | 725249 | + | NZ_LR134340.1 | Escherichia marmotae |
5 | 3491067 | 3491132 | - | NZ_CP061527.1 | Shigella dysenteriae |
6 | 3051444 | 3051515 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
7 | 3549132 | 3549197 | + | NZ_CP033744.1 | Citrobacter freundii |
8 | 104214 | 104279 | + | NZ_AP014857.1 | Escherichia albertii |
9 | 1507596 | 1507661 | - | NZ_CP044098.1 | Citrobacter portucalensis |
10 | 4797225 | 4797290 | - | NZ_CP045205.1 | Citrobacter telavivensis |
11 | 5023809 | 5023880 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
12 | 2575744 | 2575809 | - | NZ_CP038469.1 | Citrobacter tructae |
13 | 2327871 | 2327942 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
14 | 3749597 | 3749668 | - | NZ_CP011602.1 | Phytobacter ursingii |
15 | 4005797 | 4005874 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
16 | 3874705 | 3874770 | - | NZ_CP035129.1 | Kosakonia cowanii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF08245.14 | 1.0 | 15 | 2562.0 | same-strand | Mur ligase middle domain |
2 | PF02875.23 | 1.0 | 15 | 648 | same-strand | Mur ligase family, glutamate ligase domain |
3 | PF01098.21 | 1.0 | 15 | 3241.0 | same-strand | Cell cycle protein |
4 | PF03033.22 | 1.0 | 15 | 2177.0 | same-strand | Glycosyltransferase family 28 N-terminal domain |
5 | PF04101.18 | 1.0 | 15 | 2177.0 | same-strand | Glycosyltransferase family 28 C-terminal domain |
6 | PF01225.27 | 1.0 | 15 | 648.0 | same-strand | Mur ligase family, catalytic domain |
7 | PF07478.15 | 1.0 | 15 | -65.0 | same-strand | D-ala D-ala ligase C-terminus |
8 | PF01820.23 | 0.67 | 10 | -65 | same-strand | D-ala D-ala ligase N-terminus |
9 | PF13535.8 | 1.0 | 15 | -65.0 | same-strand | ATP-grasp domain |
10 | PF03799.17 | 1.0 | 15 | 202.0 | same-strand | Cell division protein FtsQ |
11 | PF08478.12 | 1.0 | 15 | 202.0 | same-strand | POTRA domain, FtsQ-type |
12 | PF14450.8 | 1.0 | 15 | 1029.0 | same-strand | Cell division protein FtsA |
13 | PF02491.22 | 1.0 | 15 | 1029.0 | same-strand | SHS2 domain inserted in FTSA |
14 | PF00091.27 | 1.0 | 15 | 2352.0 | same-strand | Tubulin/FtsZ family, GTPase domain |
15 | PF12327.10 | 1.0 | 15 | 2352.0 | same-strand | FtsZ family, C-terminal domain |
16 | PF03331.15 | 1.0 | 15 | 3604.0 | same-strand | UDP-3-O-acyl N-acetylglycosamine deacetylase |
17 | PF00953.23 | 0.6 | 9 | 5804 | same-strand | Glycosyl transferase family 4 |
18 | PF10555.11 | 0.6 | 9 | 5804 | same-strand | Phospho-N-acetylmuramoyl-pentapeptide-transferase signature 1 |