Result : EXP00707
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00707 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 897731 |
| Right | 897811 |
| Strand | + |
| Nucleotide Sequence | TTGAATGTGATAACTGTCAGGCTCTGCATCTGCCCCATATGCAGAATTTCGACGGTGTCTTTGATGCCAAAATCGATCTGA |
| Sequence | LNVITVRLCICPICRISTVSLMPKSI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 29
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1018315 | 1018395 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 893027 | 893107 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 839782 | 839862 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2922309 | 2922389 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1542372 | 1542452 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3708352 | 3708435 | - | NZ_CP054254.1 | Klebsiella variicola |
| 7 | 1511383 | 1511457 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 8 | 1462333 | 1462407 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 9 | 1415564 | 1415644 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 10 | 4027877 | 4027957 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 11 | 1962445 | 1962525 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 12 | 4526344 | 4526424 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 13 | 977537 | 977614 | + | NZ_CP067057.1 | Rahnella aceris |
| 14 | 1374861 | 1374941 | + | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 15 | 418095 | 418175 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 16 | 3076403 | 3076489 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 17 | 2056499 | 2056567 | + | NZ_LT615367.1 | Dickeya aquatica |
| 18 | 1458499 | 1458579 | + | NC_015968.1 | Enterobacter soli |
| 19 | 97832 | 97915 | - | NZ_CP019706.1 | Pantoea alhagi |
| 20 | 3285766 | 3285846 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 21 | 918257 | 918337 | + | NZ_AP014857.1 | Escherichia albertii |
| 22 | 3612517 | 3612609 | + | NZ_CP011078.1 | Yersinia ruckeri |
| 23 | 4245808 | 4245891 | + | NZ_CP049115.1 | Pantoea stewartii |
| 24 | 2635886 | 2635960 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 25 | 1203231 | 1203305 | - | NZ_CP009787.1 | Yersinia rohdei |
| 26 | 946049 | 946123 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 27 | 1376167 | 1376250 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 28 | 1595742 | 1595822 | + | NZ_CP050150.1 | Hafnia alvei |
| 29 | 3166676 | 3166768 | + | NZ_CP065640.1 | Serratia rubidaea |
| 30 | 917040 | 917132 | - | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00462.26 | 0.83 | 24 | 2031 | opposite-strand | Glutaredoxin |
| 2 | PF00881.26 | 0.86 | 25 | 1118.5 | same-strand | Nitroreductase family |
| 3 | PF08443.13 | 0.83 | 24 | 158 | same-strand | RimK-like ATP-grasp domain |
| 4 | PF18030.3 | 0.83 | 24 | 158 | same-strand | RimK PreATP-grasp domain |
| 5 | PF02955.18 | 0.66 | 19 | 158.0 | same-strand | Prokaryotic glutathione synthetase, ATP-grasp domain |
| 6 | PF02655.16 | 0.83 | 24 | 158 | same-strand | ATP-grasp domain |
| 7 | PF10722.11 | 1.0 | 29 | -80.0 | same-strand | Putative bacterial sensory transduction regulator |
| 8 | PF13416.8 | 0.9 | 26 | 678 | same-strand | Bacterial extracellular solute-binding protein |
| 9 | PF13343.8 | 0.9 | 26 | 678 | same-strand | Bacterial extracellular solute-binding protein |
| 10 | PF01547.27 | 0.9 | 26 | 678 | same-strand | Bacterial extracellular solute-binding protein |
| 11 | PF13531.8 | 0.9 | 26 | 678 | same-strand | Bacterial extracellular solute-binding protein |
| 12 | PF00005.29 | 0.9 | 26 | 1907 | same-strand | ABC transporter |
| 13 | PF08402.12 | 0.9 | 26 | 1907 | same-strand | TOBE domain |
| 14 | PF00528.24 | 0.97 | 28 | 3245.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 15 | PF10767.11 | 0.69 | 20 | 4901 | same-strand | Protein of unknown function (DUF2593) |
++ More..