Result : EXP00706
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00706 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 177891 |
| Right | 177938 |
| Strand | + |
| Nucleotide Sequence | ATGGAACGTGCGAGTAAAATGCCGTCATCTTATTTGTATGACCAATAA |
| Sequence | MERASKMPSSYLYDQ |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed equally in exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSE3 |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 166703 | 166750 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 179248 | 179295 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 175048 | 175095 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 3439013 | 3439060 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00593.26 | 1.0 | 3 | 5198.0 | same-strand | TonB dependent receptor |
| 2 | PF07715.17 | 1.0 | 3 | 5198.0 | same-strand | TonB-dependent Receptor Plug Domain |
| 3 | PF00005.29 | 1.0 | 3 | 4350.0 | same-strand | ABC transporter |
| 4 | PF01497.20 | 1.0 | 3 | 3013.5 | both-strands | Periplasmic binding protein |
| 5 | PF01032.20 | 1.0 | 3 | 1481.0 | same-strand | FecCD transport family |
| 6 | PF00202.23 | 1.0 | 3 | 166.0 | opposite-strand | Aminotransferase class-III |
| 7 | PF00654.22 | 1.0 | 3 | 12.0 | same-strand | Voltage gated chloride channel |
| 8 | PF01521.22 | 1.0 | 3 | 1515.0 | same-strand | Iron-sulphur cluster biosynthesis |
| 9 | PF03458.15 | 1.0 | 3 | 1906.0 | opposite-strand | Glycine transporter |
| 10 | PF01048.22 | 1.0 | 3 | 3360.0 | opposite-strand | Phosphorylase superfamily |
++ More..