Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00704 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 179395 |
Right | 179460 |
Strand | + |
Nucleotide Sequence | ATGGCGATTATTATTGGGTTAGAATTTGCCCAATTGCCGATGTCGTTTGGAGCAAAATATGAGTGA |
Sequence | MAIIIGLEFAQLPMSFGAKYE |
Source of smORF | Ribo-seq |
Function | INDUCTION: Expressed in both exponential and stationary phase; expression is considerably higher in exponential phase (at protein level) Pubmed:29645342 |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Gene Ontology/Expression based functional assignment |
Uniprot ID | P0DPM7 |
ORF Length (Amino Acid) | 21 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 180752 | 180817 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 176552 | 176617 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 3731773 | 3731838 | + | NZ_CP057657.1 | Escherichia fergusonii |
4 | 3437491 | 3437556 | - | NZ_CP061527.1 | Shigella dysenteriae |
5 | 800700 | 800765 | + | NZ_LR134340.1 | Escherichia marmotae |
6 | 168207 | 168272 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
7 | 181269 | 181334 | + | NZ_AP014857.1 | Escherichia albertii |
8 | 1422821 | 1422886 | - | NZ_CP044098.1 | Citrobacter portucalensis |
9 | 2824194 | 2824259 | + | NZ_CP053416.1 | Salmonella bongori |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00005.29 | 0.88 | 7 | 5892.0 | same-strand | ABC transporter |
2 | PF01497.20 | 1.0 | 8 | 2651.5 | both-strands | Periplasmic binding protein |
3 | PF01032.20 | 1.0 | 8 | 2985 | same-strand | FecCD transport family |
4 | PF00202.23 | 1.0 | 8 | 1670 | opposite-strand | Aminotransferase class-III |
5 | PF00654.22 | 1.0 | 8 | 24 | same-strand | Voltage gated chloride channel |
6 | PF01521.22 | 1.0 | 8 | -7 | same-strand | Iron-sulphur cluster biosynthesis |
7 | PF03458.15 | 1.0 | 8 | 384 | opposite-strand | Glycine transporter |
8 | PF01048.22 | 1.0 | 8 | 1838 | opposite-strand | Phosphorylase superfamily |