Result : EXP00698
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00698 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4558019 |
| Right | 4558072 |
| Strand | + |
| Nucleotide Sequence | TTGTCGAGATTTATTTTTTATAAAATTATCCTAAGTAAACAGAAGGATATGTAG |
| Sequence | LSRFIFYKIILSKQKDM |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5497644 | 5497697 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4656233 | 4656286 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 4640718 | 4640771 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 4606268 | 4606321 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 626120 | 626173 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3615552 | 3615605 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05981.14 | 0.8 | 4 | 4724 | same-strand | CreA protein |
| 2 | PF00072.26 | 1.0 | 5 | 412 | opposite-strand | Response regulator receiver domain |
| 3 | PF00486.30 | 1.0 | 5 | 412 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 4 | PF02518.28 | 0.8 | 4 | 2598 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 5 | PF00512.27 | 1.0 | 5 | 2598.0 | same-strand | His Kinase A (phospho-acceptor) domain |
| 6 | PF00672.27 | 1.0 | 5 | 2598.0 | same-strand | HAMP domain |
| 7 | PF14501.8 | 0.8 | 4 | 2598 | same-strand | GHKL domain |
| 8 | PF06123.14 | 1.0 | 5 | 1188.0 | same-strand | Inner membrane protein CreD |
| 9 | PF00588.21 | 1.0 | 5 | 171.0 | same-strand | SpoU rRNA Methylase family |
++ More..