Result : EXP00692
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00692 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1285305 |
| Right | 1285358 |
| Strand | + |
| Nucleotide Sequence | ATGCTGTCAAAAGGCGTATTGTCAGCGCGTCTTTTCAACCTTATTTATGGCTAA |
| Sequence | MLSKGVLSARLFNLIYG |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed at high levels equally in exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSE9 |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1742694 | 1742747 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1298514 | 1298567 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1293991 | 1294044 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2400385 | 2400438 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1306060 | 1306113 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00483.25 | 0.75 | 3 | 5165 | same-strand | Nucleotidyl transferase |
| 2 | PF00816.23 | 0.75 | 3 | 5101.5 | opposite-strand | H-NS histone family |
| 3 | PF00265.20 | 0.75 | 3 | 3881.5 | same-strand | Thymidine kinase |
| 4 | PF00465.21 | 1.0 | 4 | 393 | opposite-strand | Iron-containing alcohol dehydrogenase |
| 5 | PF00171.24 | 1.0 | 4 | 393 | opposite-strand | Aldehyde dehydrogenase family |
| 6 | PF01914.19 | 0.75 | 3 | 31.0 | same-strand | MarC family integral membrane protein |
| 7 | PF00496.24 | 1.0 | 4 | 1513 | same-strand | Bacterial extracellular solute-binding proteins, family 5 Middle |
++ More..