Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00689 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 1702940 |
Right | 1703143 |
Strand | + |
Nucleotide Sequence | GTGAAAAATGGCGCACATTGTGCGCCATTTTTTTTGTCTGCCGTTTACCGCTACTGCGTCACGCGTAACATATTCCCTTGCTCTGGTTCACCATTCTGCGCTGACTCTACTGAAGGCGCATTGCTGGCTGCGGGAGTTGCTCCACTGCTCACCGAAACCGGATACCCTGCCCGACGATACAACGCTTTATCGACTAACTTCTGA |
Sequence | VKNGAHCAPFFLSAVYRYCVTRNIFPCSGSPFCADSTEGALLAAGVAPLLTETGYPARRYNALSTNF |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 67 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1757671 | 1757874 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 2061225 | 2061428 | - | NZ_LR134340.1 | Escherichia marmotae |
3 | 1739281 | 1739451 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 1864175 | 1864345 | - | NZ_CP061527.1 | Shigella dysenteriae |
5 | 2357552 | 2357722 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
6 | 1692350 | 1692520 | + | NZ_AP014857.1 | Escherichia albertii |
7 | 1635733 | 1635915 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
8 | 2193993 | 2194184 | - | NZ_CP043318.1 | Enterobacter chengduensis |
9 | 1984527 | 1984718 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
10 | 1957577 | 1957768 | - | NZ_AP022508.1 | Enterobacter bugandensis |
11 | 1904128 | 1904319 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00224.23 | 1.0 | 10 | 590 | same-strand | Pyruvate kinase, barrel domain |
2 | PF02887.18 | 1.0 | 10 | 590 | same-strand | Pyruvate kinase, alpha/beta domain |
3 | PF04728.15 | 1.0 | 10 | 44 | same-strand | Lipoprotein leucine-zipper |
4 | PF17969.3 | 1.0 | 10 | -153 | opposite-strand | L,D-transpeptidase C-terminal domain |
5 | PF03734.16 | 1.0 | 10 | -153 | opposite-strand | L,D-transpeptidase catalytic domain |
6 | PF01476.22 | 1.0 | 10 | -153 | opposite-strand | LysM domain |
7 | PF02657.17 | 1.0 | 10 | 1000 | opposite-strand | Fe-S metabolism associated domain |
8 | PF00266.21 | 0.9 | 9 | 1399.5 | opposite-strand | Aminotransferase class-V |
9 | PF01458.19 | 0.9 | 9 | 2616.5 | opposite-strand | SUF system FeS cluster assembly, SufBD |
10 | PF00005.29 | 0.8 | 8 | 3892 | opposite-strand | ABC transporter |