Result : EXP00681
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00681 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 966793 |
| Right | 966861 |
| Strand | + |
| Nucleotide Sequence | GTGTTAACTTTGAGCGCCTTTTGGCCGAGATCAAAGAACGCGACGACCGCGATCGTAACCGAGCGGTAG |
| Sequence | VLTLSAFWPRSKNATTAIVTER |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 17
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1091347 | 1091415 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 961703 | 961771 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1461967 | 1462035 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 945494 | 945562 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 1635600 | 1635668 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 1747489 | 1747557 | - | NZ_CP038469.1 | Citrobacter tructae |
| 7 | 4469920 | 4469988 | + | NZ_CP033744.1 | Citrobacter freundii |
| 8 | 35720 | 35788 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 9 | 646321 | 646389 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 10 | 2875535 | 2875612 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 11 | 3362866 | 3362934 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 12 | 1699440 | 1699508 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 13 | 3491375 | 3491443 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 14 | 1305361 | 1305429 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 15 | 3136070 | 3136138 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 16 | 2082442 | 2082510 | - | NZ_CP065534.1 | Lonsdalea populi |
| 17 | 2125897 | 2125953 | + | NC_008700.1 | Shewanella amazonensis SB2B |
| 18 | 2474876 | 2474944 | - | NZ_LR134531.1 | Pragia fontium |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00266.21 | 0.94 | 16 | 2104 | same-strand | Aminotransferase class-V |
| 2 | PF00275.22 | 0.94 | 16 | 689 | same-strand | EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase) |
| 3 | PF02224.20 | 1.0 | 17 | -68.0 | same-strand | Cytidylate kinase |
| 4 | PF13189.8 | 0.82 | 14 | -68 | same-strand | Cytidylate kinase-like family |
| 5 | PF00575.25 | 1.0 | 17 | 227.0 | same-strand | S1 RNA binding domain |
| 6 | PF00216.23 | 1.0 | 17 | 2057.0 | same-strand | Bacterial DNA-binding protein |
| 7 | PF03772.18 | 0.88 | 15 | 2549.0 | same-strand | Competence protein |
| 8 | PF00753.29 | 0.88 | 15 | 2549.5 | same-strand | Metallo-beta-lactamase superfamily |
| 9 | PF00664.25 | 0.82 | 14 | 4851 | same-strand | ABC transporter transmembrane region |
| 10 | PF00005.29 | 0.82 | 14 | 4851 | same-strand | ABC transporter |
| 11 | PF02463.21 | 0.76 | 13 | 4850.5 | same-strand | RecF/RecN/SMC N terminal domain |
| 12 | PF00270.31 | 0.82 | 14 | 4851 | same-strand | DEAD/DEAH box helicase |
| 13 | PF13191.8 | 0.76 | 13 | 4851.5 | same-strand | AAA ATPase domain |
++ More..