Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00679 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 1458852 |
Right | 1458890 |
Strand | + |
Nucleotide Sequence | TTGCCTGTGGAGAGATGGTGCAGTCAGGCCGCCCGTTGA |
Sequence | LPVERWCSQAAR |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 12 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3246200 | 3246238 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 5283469 | 5283507 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
3 | 1504789 | 1504827 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
4 | 2006712 | 2006750 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
5 | 1711729 | 1711767 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
6 | 580370 | 580408 | - | NZ_CP057657.1 | Escherichia fergusonii |
7 | 4271729 | 4271767 | - | NZ_CP053416.1 | Salmonella bongori |
8 | 1212690 | 1212728 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01385.21 | 1.0 | 5 | -38.0 | same-strand | Probable transposase |
2 | PF07282.13 | 1.0 | 5 | -38.0 | same-strand | Putative transposase DNA-binding domain |