Result : EXP00678

Protein Information

• Protein name: EXP00678
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 3582105
• Right: 3582152
• Strand: +
• Nucleotide Sequence: TTGATACCCCTCGTAGTGCACATTCCTTTAACGCTTCAAAATCTGTAA
• Sequence: LIPLVVHIPLTLQNL
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4467650	4467697	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	3719951	3719998	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	3691015	3691062	+	NC_004337.2	Shigella flexneri 2a str. 301
4	3911308	3911355	+	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00384.24	1.0	3	3557.0	opposite-strand	Molybdopterin oxidoreductase
2	PF01568.23	1.0	3	3557.0	opposite-strand	Molydopterin dinucleotide binding domain
3	PF18364.3	0.67	2	3557	opposite-strand	Molybdopterin oxidoreductase N-terminal domain
4	PF00691.22	1.0	3	2745.0	same-strand	OmpA family
5	PF13488.8	0.67	2	2745	same-strand	Glycine zipper
6	PF13441.8	0.67	2	2745	same-strand	YMGG-like Gly-zipper
7	PF05433.17	0.67	2	2745	same-strand	Glycine zipper 2TM domain
8	PF02826.21	1.0	3	1667.0	same-strand	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain
9	PF00389.32	1.0	3	1667.0	same-strand	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
10	PF11254.10	1.0	3	907.0	opposite-strand	Protein of unknown function (DUF3053)
11	PF00313.24	1.0	3	51.0	same-strand	'Cold-shock' DNA-binding domain
12	PF01848.18	1.0	3	450.5	opposite-strand	Hok/gef family
13	PF02092.19	0.67	2	926	opposite-strand	Glycyl-tRNA synthetase beta subunit
14	PF05746.17	0.67	2	926	opposite-strand	DALR anticodon binding domain
15	PF02091.17	0.67	2	3005.0	opposite-strand	Glycyl-tRNA synthetase alpha subunit
16	PF13983.8	0.67	2	4011.0	opposite-strand	YsaB-like lipoprotein
17	PF13518.8	0.67	2	1117.0	both-strands	Helix-turn-helix domain
18	PF13333.8	0.67	2	1195.0	both-strands	Integrase core domain
19	PF13683.8	0.67	2	1195.0	both-strands	Integrase core domain