Result : EXP00675
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00675 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3400337 |
| Right | 3400390 |
| Strand | + |
| Nucleotide Sequence | TTGAGTCAGATTATTATTCAAACCAACATTCGCACACATTTTAAGTATTGCTGA |
| Sequence | LSQIIIQTNIRTHFKYC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4252279 | 4252332 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3539976 | 3540029 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3509243 | 3509296 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 197858 | 197911 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01293.22 | 1.0 | 3 | 5526.5 | same-strand | Phosphoenolpyruvate carboxykinase |
| 2 | PF02518.28 | 1.0 | 3 | 4098.5 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 3 | PF00512.27 | 1.0 | 3 | 4098.5 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 4 | PF00672.27 | 1.0 | 3 | 4098.5 | opposite-strand | HAMP domain |
| 5 | PF00072.26 | 1.0 | 3 | 3382.5 | opposite-strand | Response regulator receiver domain |
| 6 | PF00486.30 | 1.0 | 3 | 3382.5 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 7 | PF03449.17 | 1.0 | 3 | 2678.5 | same-strand | Transcription elongation factor, N-terminal |
| 8 | PF01272.21 | 1.0 | 3 | 2678.5 | same-strand | Transcription elongation factor, GreA/GreB, C-term |
| 9 | PF09371.12 | 1.0 | 3 | 260.5 | same-strand | Tex-like protein N-terminal domain |
| 10 | PF16921.7 | 1.0 | 3 | 260.5 | same-strand | Tex protein YqgF-like domain |
| 11 | PF12836.9 | 1.0 | 3 | 260.5 | same-strand | Helix-hairpin-helix motif |
| 12 | PF00575.25 | 1.0 | 3 | 260.5 | same-strand | S1 RNA binding domain |
| 13 | PF17674.3 | 1.0 | 3 | 260.5 | same-strand | HHH domain |
| 14 | PF14635.8 | 1.0 | 3 | 260.5 | same-strand | Helix-hairpin-helix motif |
| 15 | PF14639.8 | 0.67 | 2 | 251 | same-strand | Holliday-junction resolvase-like of SPT6 |
| 16 | PF04023.16 | 1.0 | 3 | 134.0 | same-strand | FeoA domain |
| 17 | PF02421.20 | 1.0 | 3 | 378.0 | same-strand | Ferrous iron transport protein B |
| 18 | PF07670.16 | 1.0 | 3 | 378.0 | same-strand | Nucleoside recognition |
| 19 | PF07664.14 | 1.0 | 3 | 378.0 | same-strand | Ferrous iron transport protein B C terminus |
| 20 | PF01926.25 | 1.0 | 3 | 378.0 | same-strand | 50S ribosome-binding GTPase |
| 21 | PF17910.3 | 1.0 | 3 | 378.0 | same-strand | FeoB cytosolic helical domain |
| 22 | PF09012.12 | 1.0 | 3 | 2699.0 | same-strand | FeoC like transcriptional regulator |
| 23 | PF04754.14 | 1.0 | 3 | 3138.0 | same-strand | Putative transposase, YhgA-like |
| 24 | PF00561.22 | 0.67 | 2 | 4043 | opposite-strand | alpha/beta hydrolase fold |
| 25 | PF12697.9 | 0.67 | 2 | 4043 | opposite-strand | Alpha/beta hydrolase family |
| 26 | PF12146.10 | 0.67 | 2 | 4043 | opposite-strand | Serine aminopeptidase, S33 |
| 27 | PF00975.22 | 0.67 | 2 | 4043 | opposite-strand | Thioesterase domain |
++ More..