Result : EXP00672
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00672 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3986566 |
| Right | 3986622 |
| Strand | + |
| Nucleotide Sequence | ATGATGTCAATCAGATTGCTGACAACGTGCGCGTTGTTCATGCCGGATGCGGCGTGA |
| Sequence | MMSIRLLTTCALFMPDAA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4079979 | 4080035 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 899655 | 899711 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 4095388 | 4095444 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4147 | 4203 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4387072 | 4387125 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 4878742 | 4878798 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 7 | 4849635 | 4849688 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 8 | 3013842 | 3013898 | + | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09500.12 | 0.75 | 3 | 892 | same-strand | Putative thioesterase (yiiD Cterm) |
| 2 | PF00583.27 | 0.75 | 3 | 892 | same-strand | Acetyltransferase (GNAT) family |
| 3 | PF13508.9 | 0.75 | 3 | 892 | same-strand | Acetyltransferase (GNAT) domain |
| 4 | PF01402.23 | 0.75 | 3 | 469.5 | same-strand | Ribbon-helix-helix protein, copG family |
| 5 | PF04216.14 | 1.0 | 4 | 264 | opposite-strand | Protein involved in formate dehydrogenase formation |
| 6 | PF01292.22 | 1.0 | 4 | 1190 | opposite-strand | Prokaryotic cytochrome b561 |
| 7 | PF13247.8 | 1.0 | 4 | 1822 | opposite-strand | 4Fe-4S dicluster domain |
| 8 | PF09163.13 | 1.0 | 4 | 1822 | opposite-strand | Formate dehydrogenase N, transmembrane |
| 9 | PF12838.9 | 1.0 | 4 | 1822 | opposite-strand | 4Fe-4S dicluster domain |
| 10 | PF13187.8 | 1.0 | 4 | 1822 | opposite-strand | 4Fe-4S dicluster domain |
| 11 | PF13237.8 | 1.0 | 4 | 1822 | opposite-strand | 4Fe-4S dicluster domain |
| 12 | PF12837.9 | 1.0 | 4 | 1822 | opposite-strand | 4Fe-4S binding domain |
| 13 | PF14697.8 | 1.0 | 4 | 1822 | opposite-strand | 4Fe-4S dicluster domain |
| 14 | PF01568.23 | 1.0 | 4 | 2737 | opposite-strand | Molydopterin dinucleotide binding domain |
| 15 | PF04879.18 | 1.0 | 4 | 5200 | opposite-strand | Molybdopterin oxidoreductase Fe4S4 domain |
++ More..