Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00668 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 4397697 |
Right | 4397747 |
Strand | + |
Nucleotide Sequence | TTGAGTATAATTATCTTAGCGACGATTTCGACGACTCAAGAGAATAAATGA |
Sequence | LSIIILATISTTQENK |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 16 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 5341823 | 5341873 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 4530995 | 4531045 | + | NZ_AP014857.1 | Escherichia albertii |
3 | 4486105 | 4486155 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
4 | 4401441 | 4401491 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
5 | 522321 | 522371 | + | NZ_LR134340.1 | Escherichia marmotae |
6 | 3971715 | 3971765 | - | NZ_CP061527.1 | Shigella dysenteriae |
7 | 3311674 | 3311724 | + | NZ_CP033744.1 | Citrobacter freundii |
8 | 1790951 | 1791001 | - | NZ_CP044098.1 | Citrobacter portucalensis |
9 | 2795418 | 2795468 | - | NZ_CP038469.1 | Citrobacter tructae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00583.27 | 0.88 | 7 | 6554.0 | opposite-strand | Acetyltransferase (GNAT) family |
2 | PF13508.9 | 0.88 | 7 | 6554.0 | opposite-strand | Acetyltransferase (GNAT) domain |
3 | PF13302.9 | 0.88 | 7 | 6554.0 | opposite-strand | Acetyltransferase (GNAT) domain |
4 | PF00133.24 | 1.0 | 8 | 2268 | opposite-strand | tRNA synthetases class I (I, L, M and V) |
5 | PF08264.15 | 1.0 | 8 | 2268 | opposite-strand | Anticodon-binding domain of tRNA ligase |
6 | PF10458.11 | 1.0 | 8 | 2268 | opposite-strand | Valyl tRNA synthetase tRNA binding arm |
7 | PF04364.15 | 1.0 | 8 | 1825 | opposite-strand | DNA polymerase III chi subunit, HolC |
8 | PF00883.23 | 1.0 | 8 | 154 | opposite-strand | Cytosol aminopeptidase family, catalytic domain |
9 | PF02789.19 | 1.0 | 8 | 154 | opposite-strand | Cytosol aminopeptidase family, N-terminal domain |
10 | PF03739.16 | 1.0 | 8 | 659.5 | same-strand | Lipopolysaccharide export system permease LptF/LptG |
11 | PF05872.14 | 1.0 | 8 | 2396 | opposite-strand | Bacterial protein of unknown function (DUF853) |
12 | PF08240.14 | 0.75 | 6 | 4018.5 | opposite-strand | Alcohol dehydrogenase GroES-like domain |
13 | PF00107.28 | 0.75 | 6 | 4018.5 | opposite-strand | Zinc-binding dehydrogenase |
14 | PF13602.8 | 0.75 | 6 | 4018.5 | opposite-strand | Zinc-binding dehydrogenase |