Result : EXP00666

Protein Information

• Protein name: EXP00666
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 3071098
• Right: 3071151
• Strand: +
• Nucleotide Sequence: TTGCTACCGCTTTTGGTGCCATCGCACCCATTGGCTGGGATCTCACCGGAGTAA
• Sequence: LLPLLVPSHPLAGISPE
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 17

Conservation Analysis

No. of Species: 4

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3944674	3944727	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	3205016	3205069	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	2099871	2099924	+	NZ_CP057657.1	Escherichia fergusonii
4	3194123	3194176	+	NC_004337.2	Shigella flexneri 2a str. 301
5	602951	603004	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF08239.13	1.0	4	3172	same-strand	Bacterial SH3 domain
2	PF01743.22	1.0	4	1870	same-strand	Poly A polymerase head domain
3	PF12627.9	1.0	4	1870	same-strand	Probable RNA and SrmB- binding site of polymerase A
4	PF01966.24	1.0	4	1870	same-strand	HD domain
5	PF02673.20	1.0	4	886	opposite-strand	Bacitracin resistance protein BacA
6	PF02152.20	1.0	4	427	opposite-strand	Dihydroneopterin aldolase
7	PF02660.17	1.0	4	-53	same-strand	Glycerol-3-phosphate acyltransferase
8	PF03466.22	0.75	3	255.0	opposite-strand	LysR substrate binding domain
9	PF00814.27	0.75	3	4426.0	opposite-strand	tRNA N6-adenosine threonylcarbamoyltransferase