Result : EXP00664
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00664 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3337341 |
| Right | 3337385 |
| Strand | + |
| Nucleotide Sequence | ATGAAATGGAGATGGCGAAACTGCGCGATCATCTGCGTCTGCTGA |
| Sequence | MKWRWRNCAIICVC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 11
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4197774 | 4197818 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3438644 | 3438688 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 3477740 | 3477784 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 3447017 | 3447061 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 2383923 | 2383967 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 362425 | 362469 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 3965822 | 3965866 | + | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 4410316 | 4410360 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 9 | 2264676 | 2264720 | + | NZ_CP033744.1 | Citrobacter freundii |
| 10 | 2818153 | 2818197 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 11 | 4725378 | 4725422 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 12 | 2868859 | 2868903 | + | NZ_CP017279.1 | Enterobacter ludwigii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02635.17 | 1.0 | 11 | 2219.5 | opposite-strand | DsrE/DsrF-like family |
| 2 | PF08348.13 | 1.0 | 11 | 1301.0 | opposite-strand | YheO-like PAS domain |
| 3 | PF13309.8 | 1.0 | 11 | 1301.0 | opposite-strand | HTH domain |
| 4 | PF13384.8 | 1.0 | 11 | 1301.0 | opposite-strand | Homeodomain-like domain |
| 5 | PF00254.30 | 1.0 | 11 | 265.0 | opposite-strand | FKBP-type peptidyl-prolyl cis-trans isomerase |
| 6 | PF01346.20 | 1.0 | 11 | 321.0 | opposite-strand | Domain amino terminal to FKBP-type peptidyl-prolyl isomerase |
| 7 | PF04102.14 | 1.0 | 11 | -44.0 | same-strand | SlyX |
| 8 | PF09526.12 | 1.0 | 11 | 808.0 | opposite-strand | Probable metal-binding protein (DUF2387) |
| 9 | PF00999.23 | 0.91 | 10 | 1018 | opposite-strand | Sodium/hydrogen exchanger family |
| 10 | PF02254.20 | 1.0 | 11 | 1018.0 | opposite-strand | TrkA-N domain |
| 11 | PF02525.19 | 1.0 | 11 | 2823.0 | opposite-strand | Flavodoxin-like fold |
| 12 | PF00005.29 | 0.73 | 8 | 3505 | same-strand | ABC transporter |
| 13 | PF12848.9 | 0.73 | 8 | 3505 | same-strand | ABC transporter |
| 14 | PF16326.7 | 0.73 | 8 | 3505 | same-strand | ABC transporter C-terminal domain |
++ More..