Result : EXP00658
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00658 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2870854 |
| Right | 2870940 |
| Strand | + |
| Nucleotide Sequence | ATGTGCTCATTCTGGGTATCCCGACCTGGGATTTTGGTGAAATCCAGGAAGACTGGGAAGCCGTCTGGGATCAGCTCGACGACCTGA |
| Sequence | MCSFWVSRPGILVKSRKTGKPSGISSTT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3039994 | 3040080 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2973908 | 2973994 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 654070 | 654156 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 3778270 | 3778356 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 1933719 | 1933805 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 2976072 | 2976158 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 3517598 | 3517684 | + | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 734065 | 734139 | - | NZ_CP031560.1 | Dickeya dianthicola |
| 9 | 3655730 | 3655804 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 10 | 718642 | 718716 | - | NC_014500.1 | Dickeya dadantii 3937 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00472.22 | 0.89 | 8 | 3929 | opposite-strand | RF-1 domain |
| 2 | PF02272.21 | 1.0 | 9 | 1888.0 | opposite-strand | DHHA1 domain |
| 3 | PF01368.22 | 1.0 | 9 | 1888.0 | opposite-strand | DHH family |
| 4 | PF17768.3 | 1.0 | 9 | 1888.0 | opposite-strand | RecJ OB domain |
| 5 | PF13098.8 | 1.0 | 9 | 1172.0 | opposite-strand | Thioredoxin-like domain |
| 6 | PF10411.11 | 1.0 | 9 | 1172.0 | opposite-strand | Disulfide bond isomerase protein N-terminus |
| 7 | PF00589.24 | 1.0 | 9 | 251.0 | opposite-strand | Phage integrase family |
| 8 | PF02899.19 | 1.0 | 9 | 251.0 | opposite-strand | Phage integrase, N-terminal SAM-like domain |
| 9 | PF13495.8 | 1.0 | 9 | 251.0 | opposite-strand | Phage integrase, N-terminal SAM-like domain |
| 10 | PF00258.27 | 1.0 | 9 | -86.0 | same-strand | Flavodoxin |
| 11 | PF07254.14 | 1.0 | 9 | 336.0 | opposite-strand | Membrane-bound toxin component of toxin-antitoxin system |
| 12 | PF03937.18 | 1.0 | 9 | 724.0 | opposite-strand | Flavinator of succinate dehydrogenase |
| 13 | PF03006.22 | 1.0 | 9 | 2406.5 | opposite-strand | Haemolysin-III related |
++ More..