Result : EXP00657
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00657 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 446570 |
| Right | 446611 |
| Strand | + |
| Nucleotide Sequence | GTGGATTCAAGATTGATCGAAATATGCTGCTGTGGATGCTGA |
| Sequence | VDSRLIEICCCGC |
| Source of smORF | Ribo-seq |
| Function | It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 543590 | 543631 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 414055 | 414096 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 3236562 | 3236603 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02551.17 | 0.67 | 2 | 2364.0 | opposite-strand | Acyl-CoA thioesterase |
| 2 | PF13622.8 | 0.67 | 2 | 2364.0 | opposite-strand | Thioesterase-like superfamily |
| 3 | PF09619.12 | 0.67 | 2 | 2293.0 | same-strand | Type III secretion system lipoprotein chaperone (YscW) |
| 4 | PF01035.22 | 1.0 | 3 | 1231 | opposite-strand | 6-O-methylguanine DNA methyltransferase, DNA binding domain |
| 5 | PF07237.13 | 1.0 | 3 | 499 | same-strand | Protein of unknown function (DUF1428) |
| 6 | PF00563.22 | 1.0 | 3 | -41 | opposite-strand | EAL domain |
| 7 | PF12792.9 | 0.67 | 2 | -41.0 | opposite-strand | CSS motif domain associated with EAL |
| 8 | PF10777.11 | 0.67 | 2 | 1216.0 | opposite-strand | Inner membrane protein YlaC |
| 9 | PF14602.8 | 0.67 | 2 | 1802.0 | opposite-strand | Hexapeptide repeat of succinyl-transferase |
| 10 | PF00132.26 | 0.67 | 2 | 1802.0 | opposite-strand | Bacterial transferase hexapeptide (six repeats) |
| 11 | PF05321.13 | 0.67 | 2 | 2525.0 | opposite-strand | Haemolysin expression modulating protein |
| 12 | PF10757.11 | 0.67 | 2 | 2769.0 | opposite-strand | Biofilm formation regulator YbaJ |
++ More..