Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00648 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 1445938 |
Right | 1446006 |
Strand | + |
Nucleotide Sequence | ATGAATCTGCTAGTCAAATGCGCGGGGAAAATCCCCGCGCTTGCCCTTACCTGGACGTGCAGGCCATGA |
Sequence | MNLLVKCAGKIPALALTWTCRP |
Source of smORF | Ribo-seq |
Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Gene Ontology/Expression based functional assignment |
Uniprot ID | P0DSF2 |
ORF Length (Amino Acid) | 22 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1491876 | 1491944 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 2009522 | 2009590 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
3 | 1829988 | 1830056 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 2000426 | 2000494 | + | NZ_CP061527.1 | Shigella dysenteriae |
5 | 2272817 | 2272885 | - | NZ_LR134340.1 | Escherichia marmotae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01292.22 | 1.0 | 4 | 444 | same-strand | Prokaryotic cytochrome b561 |
2 | PF00015.23 | 1.0 | 4 | 526 | same-strand | Methyl-accepting chemotaxis protein (MCP) signalling domain |
3 | PF02203.17 | 0.75 | 3 | 526.0 | same-strand | Tar ligand binding domain homologue |
4 | PF00672.27 | 1.0 | 4 | 526 | same-strand | HAMP domain |
5 | PF00171.24 | 0.75 | 3 | 2206 | same-strand | Aldehyde dehydrogenase family |
6 | PF00044.26 | 1.0 | 4 | 1163.0 | opposite-strand | Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain |