Result : EXP00648
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00648 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1445938 |
| Right | 1446006 |
| Strand | + |
| Nucleotide Sequence | ATGAATCTGCTAGTCAAATGCGCGGGGAAAATCCCCGCGCTTGCCCTTACCTGGACGTGCAGGCCATGA |
| Sequence | MNLLVKCAGKIPALALTWTCRP |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSF2 |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1491876 | 1491944 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2009522 | 2009590 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1829988 | 1830056 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2000426 | 2000494 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2272817 | 2272885 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01292.22 | 1.0 | 4 | 444 | same-strand | Prokaryotic cytochrome b561 |
| 2 | PF00015.23 | 1.0 | 4 | 526 | same-strand | Methyl-accepting chemotaxis protein (MCP) signalling domain |
| 3 | PF02203.17 | 0.75 | 3 | 526.0 | same-strand | Tar ligand binding domain homologue |
| 4 | PF00672.27 | 1.0 | 4 | 526 | same-strand | HAMP domain |
| 5 | PF00171.24 | 0.75 | 3 | 2206 | same-strand | Aldehyde dehydrogenase family |
| 6 | PF00044.26 | 1.0 | 4 | 1163.0 | opposite-strand | Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain |
++ More..