Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00646 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 2622005 |
Right | 2622064 |
Strand | + |
Nucleotide Sequence | CTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGGGGCGGTTGGCCTCGTAA |
Sequence | LDSTGFAKPKVHAEGRLAS |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 19 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 5110225 | 5110287 | + | NZ_CP040428.1 | Jejubacter calystegiae |
2 | 2730063 | 2730125 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
3 | 2821895 | 2821957 | + | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
4 | 2626208 | 2626270 | + | NZ_CP029185.2 | Limnobaculum parvum |
5 | 735232 | 735294 | + | NZ_CP009056.1 | Frischella perrara |
6 | 1103852 | 1103914 | - | NZ_LR134531.1 | Pragia fontium |
7 | 1669301 | 1669360 | - | NC_009831.1 | Shewanella sediminis HAW-EB3 |
8 | 1375247 | 1375309 | - | NZ_LR134376.1 | Aeromonas encheleia |
9 | 3304783 | 3304845 | + | NZ_AP022188.1 | Aeromonas media |
10 | 2061059 | 2061121 | + | NZ_CP065745.1 | Aeromonas allosaccharophila |
11 | 2069465 | 2069527 | + | NZ_CP051883.1 | Aeromonas salmonicida |
12 | 2483536 | 2483598 | + | NC_012691.1 | Tolumonas auensis DSM 9187 |
13 | 1573567 | 1573629 | - | NZ_CP050851.1 | Aeromonas hydrophila |
14 | 1794316 | 1794378 | + | NZ_CP044060.1 | Aeromonas veronii |
15 | 2963802 | 2963861 | + | NC_019940.1 | Thioflavicoccus mobilis 8321 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03658.16 | 0.73 | 11 | 1376 | opposite-strand | RnfH family Ubiquitin |
2 | PF03364.22 | 0.73 | 11 | 850 | opposite-strand | Polyketide cyclase / dehydrase and lipid transport |
3 | PF10604.11 | 0.73 | 11 | 850 | opposite-strand | Polyketide cyclase / dehydrase and lipid transport |
4 | PF01668.20 | 0.8 | 12 | 142.0 | same-strand | SmpB protein |