Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00640 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 3389455 |
Right | 3389541 |
Strand | + |
Nucleotide Sequence | TTGATTTATTACTTTCCACCCACACATTTGGTTATCCGAAAGAGGATCAGCGGTTATGGCATGCAGTGGCCGAAGCTACGGGTCTGA |
Sequence | LIYYFPPTHLVIRKRISGYGMQWPKLRV |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 28 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2428669 | 2428755 | + | NZ_CP057657.1 | Escherichia fergusonii |
2 | 4241397 | 4241483 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
3 | 3484743 | 3484829 | + | NZ_AP014857.1 | Escherichia albertii |
4 | 3529075 | 3529161 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
5 | 3498289 | 3498375 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
6 | 4012561 | 4012647 | + | NZ_LR134340.1 | Escherichia marmotae |
7 | 186183 | 186269 | + | NZ_CP061527.1 | Shigella dysenteriae |
8 | 4421670 | 4421756 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
9 | 5072873 | 5072959 | - | NZ_CP011602.1 | Phytobacter ursingii |
10 | 2314408 | 2314494 | + | NZ_CP033744.1 | Citrobacter freundii |
11 | 2761645 | 2761731 | - | NZ_CP044098.1 | Citrobacter portucalensis |
12 | 4678013 | 4678099 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
13 | 912235 | 912321 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
14 | 1604965 | 1605051 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
15 | 77396 | 77482 | + | NZ_CP045205.1 | Citrobacter telavivensis |
16 | 72471 | 72557 | - | NZ_CP046293.1 | Yersinia intermedia |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00912.24 | 1.0 | 15 | 3609.5 | same-strand | Transglycosylase |
2 | PF17092.7 | 1.0 | 15 | 3609.5 | same-strand | Penicillin-binding protein OB-like domain |
3 | PF00293.30 | 0.93 | 14 | 2927 | opposite-strand | NUDIX domain |
4 | PF07095.13 | 1.0 | 15 | 471.0 | same-strand | Intracellular growth attenuator protein IgaA |
5 | PF13419.8 | 1.0 | 15 | -86.0 | same-strand | Haloacid dehalogenase-like hydrolase |
6 | PF01479.27 | 1.0 | 15 | 187.0 | same-strand | S4 domain |
7 | PF01430.21 | 1.0 | 15 | 613.0 | same-strand | Hsp33 protein |
8 | PF01293.22 | 0.93 | 14 | 1909 | same-strand | Phosphoenolpyruvate carboxykinase |
9 | PF02518.28 | 0.67 | 10 | 3653 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
10 | PF00512.27 | 0.67 | 10 | 3653 | opposite-strand | His Kinase A (phospho-acceptor) domain |
11 | PF00672.27 | 0.67 | 10 | 3653 | opposite-strand | HAMP domain |