Result : EXP00639

Protein Information

• Protein name: EXP00639
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 4284477
• Right: 4284515
• Strand: +
• Nucleotide Sequence: ATGACACTTTCAGCGCAGCGCGAGTTGGTGCGCCGGTAA
• Sequence: MTLSAQRELVRR
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	5231809	5231847	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	4377401	4377439	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	4481787	4481825	+	NC_004337.2	Shigella flexneri 2a str. 301

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF09285.13	1.0	2	1136	same-strand	Elongation factor P, C-terminal
2	PF08207.14	1.0	2	1136	same-strand	Elongation factor P (EF-P) KOW-like domain
3	PF01132.22	1.0	2	1136	same-strand	Elongation factor P (EF-P) OB domain
4	PF08085.13	1.0	2	702	same-strand	Entericidin EcnA/B family
5	PF00893.21	1.0	2	209	same-strand	Small Multidrug Resistance protein
6	PF08212.14	1.0	2	-38	opposite-strand	Lipocalin-like domain
7	PF00061.25	1.0	2	-38	opposite-strand	Lipocalin / cytosolic fatty-acid binding protein family
8	PF00144.26	1.0	2	372	opposite-strand	Beta-lactamase
9	PF02313.19	1.0	2	1568	opposite-strand	Fumarate reductase subunit D
10	PF02300.19	1.0	2	1938	opposite-strand	Fumarate reductase subunit C
11	PF13085.8	1.0	2	2344	opposite-strand	2Fe-2S iron-sulfur cluster binding domain
12	PF13183.8	1.0	2	2344	opposite-strand	4Fe-4S dicluster domain
13	PF13237.8	1.0	2	2344	opposite-strand	4Fe-4S dicluster domain
14	PF13534.8	1.0	2	2344	opposite-strand	4Fe-4S dicluster domain
15	PF12838.9	1.0	2	2344	opposite-strand	4Fe-4S dicluster domain
16	PF13484.8	1.0	2	2344	opposite-strand	4Fe-4S double cluster binding domain
17	PF00890.26	1.0	2	3071	opposite-strand	FAD binding domain
18	PF02910.22	1.0	2	3071	opposite-strand	Fumarate reductase flavoprotein C-term