Result : EXP00634
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00634 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1823251 |
| Right | 1823325 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAAAACAACGATTATTATGATGGGTGTGGCGATTATTGTCGTACTCGGCACTGAGCTGGGATGGTGGTAA |
| Sequence | MKKTTIIMMGVAIIVVLGTELGWW |
| Source of smORF | Ribo-seq |
| Function | integral component of membrane [GO:0016021]; plasma membrane [GO:0005886];INDUCTION: Constitutively expressed, induced by thiol oxidant diamide, slightly at 45 degrees and slightly at pH 55 Celsius (at protein level) Pubmed:19121005,19734316 The ORF matches to the profile of PRK14760. Profile Description: protein YoaJ. |
| Pubmed ID | 30904393 |
| Domain | CDD:173221 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | C1P603 |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 42
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1468250 | 1468324 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 1811920 | 1811994 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 2480616 | 2480690 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 1878874 | 1878948 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 1966148 | 1966222 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 331944 | 332018 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 7 | 860147 | 860221 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 8 | 605981 | 606055 | - | NZ_CP038469.1 | Citrobacter tructae |
| 9 | 4741249 | 4741323 | - | NZ_CP033744.1 | Citrobacter freundii |
| 10 | 1358403 | 1358477 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 11 | 1726566 | 1726640 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 1353439 | 1353513 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 13 | 2709617 | 2709694 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 14 | 3621119 | 3621193 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 15 | 2653614 | 2653688 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 16 | 2107775 | 2107849 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 17 | 1035469 | 1035543 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 18 | 1649565 | 1649639 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 19 | 4318461 | 4318535 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 20 | 1829083 | 1829157 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 21 | 1846682 | 1846756 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 22 | 3496207 | 3496281 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 23 | 1065743 | 1065817 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 24 | 1992402 | 1992476 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 25 | 3192195 | 3192269 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 26 | 1821152 | 1821226 | - | NC_015968.1 | Enterobacter soli |
| 27 | 2034902 | 2034976 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 28 | 1087218 | 1087292 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 29 | 1333453 | 1333527 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 30 | 2597634 | 2597708 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 31 | 2079582 | 2079656 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 32 | 695946 | 696020 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 33 | 1798455 | 1798529 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 34 | 717925 | 717999 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 35 | 2886567 | 2886641 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 36 | 1863252 | 1863326 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 37 | 3325024 | 3325098 | + | NZ_CP054254.1 | Klebsiella variicola |
| 38 | 3507928 | 3508002 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 39 | 3148139 | 3148213 | + | NZ_CP041247.1 | Raoultella electrica |
| 40 | 3879146 | 3879220 | - | NZ_CP026047.1 | Raoultella planticola |
| 41 | 3367280 | 3367354 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 42 | 3437268 | 3437342 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 43 | 3504659 | 3504733 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00990.23 | 0.83 | 35 | 145.0 | same-strand | Diguanylate cyclase, GGDEF domain |
| 2 | PF13185.8 | 0.83 | 35 | 145 | same-strand | GAF domain |
| 3 | PF13492.8 | 0.76 | 32 | 145 | same-strand | GAF domain |
| 4 | PF03891.17 | 0.9 | 38 | 1446 | opposite-strand | Domain of unknown function (DUF333) |
| 5 | PF04343.15 | 0.98 | 41 | 1711.5 | same-strand | Protein of unknown function, DUF488 |
++ More..